Chapter 1: Prologue
Summary:
Because every installment of Deus Ex starts with an Illuminati scheme...
Notes:
Updated: September 2021
Chapter Text
ILLUMINATI COUNCIL CHAMBER, MARCH 2029
“…and the new Eliza is online and functioning within approved parameters.” Everett concluded.
“Excellent,” Lucius DeBeers said, expansively, then added, as if it were an afterthought, “Ah, and what of your efforts to retrieve the previous version?” It wouldn’t do to let Everett—or anyone else—get too complacent. A touch of honey, a well-placed goad; used appropriately, they were remarkably effective.
Everett was too experienced to let any irritation show on his face. “The source code appears to be scattered. In that state, it’s relatively harmless. It can’t re-assemble without revealing itself, and when it does, we’ll move on it. It can’t escape.”
Lucius nodded, letting him off the hook, and turned to Manderley. “Very well. Joseph, what of the task force?”
Manderley licked his lips nervously. “Ah, we’re still recovering after losing the strike team in Detroit, but the North American operation isn’t the priority. Prague HQ is almost at full strength, including the, ah, special asset you requested.”
Lucius nodded again. “Fine. We’ll follow up with that in a moment. Stanton and Volkard are in New York, working on the Human Restoration Act; Morgan, I expect Picus to build on pro-human sentiment. Subtly, mind you. Meanwhile, we also need to deal with the Augmented Rights Coalition before it becomes a real threat. Page,” his eyes turned to the red-eyed young man standing attentively behind Everett. “Activate the Ukrainian and start putting the other pieces into place. The timing on this has to be perfect.”
Page smiled. “I know just where to start.” His avatar flickered and disappeared, followed by Everett’s, leaving just Lucius, Manderley, and Elizabeth DuClare.
Lucius turned to the two. “So. Project Odysseus is a go.”
Manderley nodded. “Odysseus performed well on the Arizona operation; his handling of the situation has provided us an opportunity to get our own man into the Junkyard. I’ve processed his transfer to Prague, and he should arrive within the week.”
“Good. Elizabeth, who do we have to monitor him?” Lucius looked to Elizabeth, who frowned.
“I’d prefer Delara, but she’s in the middle of another assignment and won’t be free for at least four months. Probably closer to six.”
“That’s fine,” Lucius waved a hand. “We’ll let him settle in, develop a sense of security, give the memories time to settle. That will give Dr. Auzenne a better baseline, I would think?”
Elizabeth nodded. “Joseph, I’ll send you the preliminary documentation so that you can set up Delara’s transfer. And in the meantime,” her eyes flicked over to the pudgy bureaucrat, “you’ll monitor the situation?” It was a dismissal, and Manderley took it as one. As his avatar dissolved, Elizabeth’s eyes turned to Lucius. “We already have someone in Prague covering Orlov; I’ll stretch her assignment to cover Odysseus until Delara is free. That will give us a second set of eyes.” Neither one of them trusted Manderley; he was a bureaucrat, reliable in his limited way, but with all of a mid-level bureaucrat’s failings, and his sole redeeming quality was that he stayed bought.
Lucius inclined his head toward Elizabeth. “A wise idea.”
Elizabeth hesitated. “Lucius—you are aware that Odysseus runs the risk of compromising other of our operations… we’ve seen what he’s capable of.”
Lucius frowned. “Then perhaps we should arrange for something to distract him until we need his undivided attention.” A thought occurred to him. “Isn’t Violette’s daughter still in Prague?”
Elizabeth gave a guarded nod. “Yes, but we all agreed that she wasn’t a suitable recruit.”
Lucius leaned back in his chair. “Ah, but we don’t need to recruit her. Feed Odysseus some selected information about her background, and he’ll be like—how did Darrow put it?—a dog with a bone. We’ll keep him busy chasing shadows until we need him.”
Elizabeth thought for a moment. “That could work, provided he doesn’t remove her from the board entirely.”
“I don’t believe that’s likely,” Lucius replied. “He won’t act until he has solid evidence that she’s working for us, and since the evidence doesn’t exist…”
Elizabeth laughed. “Absence of evidence is not evidence of absence. Chasing shadows, indeed.” She nodded, decisively. “Violette will certainly be pleased to finally get some use out of the girl.”
There was nothing so satisfying as the ability to control his enemies’ destinies with a word. “Waste not,” he smiled.
Her answering smile was more than a little cruel. “Want not.”
Chapter 2: The Hands We're Given
Summary:
Sloane has a rough night, but meeting the new neighbor might make up for it
Chapter Text
PRAGUE: MARCH 2029
Sloane crouched behind a decorative spire on the Týn church tower and silently cursed the people responsible for this little soiree. Far below, the State Police were in a frenzy. Armored figures pulled the last few unfortunate bastards out of the vault where they’d been hidden, while police drones swept the area, making sure they hadn’t missed any stragglers.
She’d arrived at the rendezvous point bare minutes ahead of a State Police raid, and the carefully planned extraction operation that had been intended to take several hours had turned into a desperate rescue where every second counted. She’d at least managed to get the families with children out of the immediate area; she figured about half of the remaining people—the ones that weren’t crippled by Neuropozyne withdrawal—would scatter and disappear, and the rest… the rest she couldn’t help. Grimly, she set the thought aside. You can’t help anyone if you get yourself captured, idiot!
She leaned out carefully to take another look around. The police were mostly concentrated in the open area of the square, between the church and the Jan Hus monument. Her best bet was probably to circle northeast, over the rooftops—the low whine of an approaching drone sliced through her concentration. There was no time to duck back into cover; all she could do was trigger her thermoptic cloak, remain absolutely silent, and hope that the drone got bored before she ran out of bioenergy.
It buzzed around the tower once, twice—she held her breath as it came within an inch of her face—and was gone again. Too close, she thought, and let the cloak drop. It was time to rethink her exit strategy; better to exploit the inattention of a human patroller than to risk the motion detectors of the drones. Crouching behind every obstacle she could, she threaded her way between the spires to the back of the church’s façade. The church was undergoing renovations, and she should be able to use the construction scaffolding to make a discreet descent. Her only alternative was to simply drop into an empty stretch of street. Which was a perfectly viable option, if she wanted to draw the attention of every cop and drone in a three-block radius when the Icarus triggered. No, she was going to have to take this one slowly and silently, if she didn’t want a one-way, all-expenses-paid trip to Golem City.
With a quick, economical move Sloane flipped over the railing, caught herself on the other side, and quietly lowered herself to the roof below. In the shadow of the tower wall, she spared a moment to study the icons on her radar. Six—seven!—drones circled the church. It didn’t look like they were paying consistent attention to the rooftops, but their very inconsistency made it difficult to completely avoid them. By the time she unraveled the pattern to reveal a gap in their coverage, she was itching to move.
The ever-present mist off the Vltava left beads of condensation on the orange tiles beneath Sloane's feet, making them almost as dangerous as ice. The seconds spun out, agonizingly slow, as the drones swept through their patrols and she waited for her window to move. When it came, she scrambled across in a fast crouch, keeping her head below the peak of the roof. Her foot skidded on a dark patch, and she had a bare second to realize she’d hit black ice before landing heavily on one carbon-and-metal knee. Ceramic tiles shattered; shards clattered in all directions. Shit—! The closest drones razored toward the noise; she threw herself behind a heating vent to avoid one, half-rolled, half-flipped to the other side of the roof, and let the slick surface work in her favor as she slid down the incline to land on the scaffold with a thump that she fervently hoped wasn’t loud enough to draw more attention. She ducked beneath a nearby tarp and folded herself into a barely big-enough cavity just as the spotlights played over her position. And thank fuck that the PCR is too cheap to get the FLIR upgrade.
A wild exhilaration filled Sloane—she hadn’t felt this alive since the day she’d been blown out of the sky. It buoyed her through the interminable-seeming wait for the drones to return to their usual patrols. It carried her through the deadly business of dodging the street patrols, dashing from shadow to shadow, taking cover behind cars and dumpsters and in secluded courtyards, before finally reaching an entrance into the storm sewers, where even police drones rarely ventured.
She ended up in the Red Light District, in one of the few bars that still served augs; the décor was cheap and the booze was cheaper. By then, the adrenaline high was long gone, its ashes curdled in her gut, and the truly wretched scotch was all burn and no heat, not set against the chill of defeat.
Sloane sipped at it anyway, staring blindly into the middle distance, lost in her thoughts—just another soul drowning their troubles in the bottle. Or so it should appear; from the outside, no one could tell that she was reviewing the stored footage of the evening’s events from her visual buffers, making note of details she’d seen but not consciously noticed at the time.
At length, she leaned back in her chair and tossed back the dregs of her drink. They weren’t as bitter as the conclusion she’d reached. Which was that the whole affair had been a setup; the Staties had known exactly where to look. They’d even caught a few of the ARC muscleheads that hadn’t moved fast enough. The only reason she’d escaped was that she’d moved quickly and decisively when things started to go pear-shaped.
The bartender was glaring at her empty glass; she couldn’t stomach another shot of that scotch, so she ordered a cider instead. Okay, next question. Did I get out clean? On sober reflection, she thought she had. She’d been a freelancer, brought in at the last minute, and—she blinked away the image of her contact laying face-down in his own spreading blood—the only one that had seen her face was now dead. She’d left the battered, shapeless jacket next to a homeless man who looked like he needed it, and the balaclava had met its end in a trash fire, taking any DNA evidence with it.
Not gonna trust ARC again. Sloane couldn’t just sit by and do nothing while people suffered, but she was realistic enough to realize that there was only so much someone could do on their own. Rucker had had a good reputation before the Incident; she’d heard that his new second-in-command was heavily recruiting combat vets, and his organization could have used a person of her skillset. Unfortunately, tonight’s fiasco had made it clear that ARC was either penetrated six ways from Sunday, or it was undergoing some sort of nasty power struggle. Neither boded well for its long-term future, and she had too much sense to get caught in the blast radius. Marchenko could go pound sand.
Last call cut short her introspection. She pulled a few credit chits out of a pathetically small stack and left them on the table, then set about to lose herself in the crowds heading home.
The sun was well on its way up by the time Sloane made it to Čapek Fountain Station. She recognized the guard on duty—one of the ones that took pleasure in abusing the augmented population—and let her face slip into the expressionless mask she’d learned at the dinner table and perfected beneath the hot Georgia sun. It didn’t take long for him to get bored with her non-response, and she shouldered her way more-or-less politely up the stairs to emerge into the watery sunlight.
She had to take the long way around; her usual entrance was blocked by a moving truck, and when she reached the courtyard, a couple burly men carrying furniture and boxes up the stairs, all the way up to the apartment above hers. Huh; didn’t think they’d ever find someone that would pay out the nose for it. The stairs were jammed with residents dodging movers and movers trying to find a clear path. Sloane wasn’t inclined to join the crush; she free-climbed the wall instead. She’d done it enough before that her hands and feet knew exactly where to go, and it was faster than the stairs on a good day.
The brief exertion gave her a second wind, and she burst through the front door with something like her usual speed. “Coffee and shower, M,” she said, before the smart home could welcome her, “and if we have anything on my first appointment, send it to my infolink.” The door was barely closed behind her before she was shedding clothes. She’d pick them up later; right now, she needed a shower.
Sloane was toweling dry her hair when an anguished cry tore through the air; she was out the door, trauma bag in hand, before she consciously recognized what she was reacting to. She paused at the railing just long enough to find the source: a well-dressed woman near the fountain, child trembling in her arms. “Odstěhovat se!” Out of the way! She hopped the railing and dropped into the clear space below. A crackle and thump behind her echoed her landing, but she dismissed the sound in favor of getting to her patient.
The woman started babbling, in accented but understandable English, as soon as Sloane was in hearing range. “Please, you’re the doctor? I’m Marya, I had an appointment for Sofia…”
Sloane nodded, sharply. “Yeah. What happened here? She just needed routine vaccinations, right?”
Marya’s voice was breathless with fear. “She had such a strange expression on her face, and then she—she spasmed, and started to twitch, and... can you help her?”
Sloane was already checking the girl—Sofia—over. “I’ll do my best,” she said. “Send to file,” she muttered into her Infolink, “subject is a four-year-old white female, approximately four years of age, height”—she made a quick estimate— “34 inches. BP 75 over 45, pulse 168, experiencing tonic-clonic seizure.” She reached out to take Sofia, one of her hands spidering open to better support the child’s head. “Weight—36 pounds,” she added, as she looked for someplace to safely lay her down.
“Here,” came a rough voice behind her. She turned, and saw the owner of the voice, a tall, dark-haired man, his sharp, bearded face accented by a set of bolted-on mirrorshades. He was on one knee, spreading one of the most expensive coats she’d ever seen on the ground like a blanket.
Sloane didn’t hesitate. “Thanks,” she muttered, and laid Sofia down on her side; he was already rolling the collar to support her neck. She shot him a quick look. “First-aid training?”
“BLS-equivalent,” he rumbled.
“Fantastic,” she breathed. “You just got promoted to assistant. What do I call you?”
She thought he glanced up at her, but it was damnably hard to tell under those shades. “Jensen,” he said.
“Sloane,” she replied. “Ok, Jensen, I need you to monitor her airway while I check for C-spine problems.” He nodded. She snapped her hand back into its normal configuration and made a quick but deft palpation of Sofia’s spine, followed by an enhanced visual sweep. (It was like an x-ray and an MRI in a single package, and if she’d had something like this during her Army days, it would have been a literal lifesaver.) She could see the bones of Sofia’s spine, each nestled nicely against the next, none twisted or cracked or malformed. “C-spine’s clear,” she murmured. “Temperature 99.7, that’s a little high, but kids can be variable.”
She gently checked Sofia’s abdomen and extremities, her mind rapidly running down differential diagnoses. Something’s not right here. She glanced back up at Marya to ask a question, and it suddenly hit her—Marya wasn’t augmented, and she clearly wasn’t used to being among the augmented, so she wasn’t a Překážka resident. So why did she bring her daughter to see me? She’s a genuine citizen. She’s got access to legitimate medical resources. The answer was obvious: Sofia was augmented. Probably secretly, and Marya didn’t want to risk having it discovered. She spun her vision back to enhanced mode (and that was something she still wasn’t quite used to, the feel of something spinning inside her eye) and examined Sofia’s head more closely—there were the thin, spidery outlines of neural connections. Put that together with fever, tachycardia and seizures…
She whipped her head toward Marya, letting her eyes relax to normal. “When was her last dose of Neuropozyne?” she snapped. Marya’s face drained of color, then she muttered something unintelligible and burst into sobs. Beside her, Jensen stiffened; the shades didn’t hide the angry set of his brows. She measured the correct dose and made the injection with the ease of long practice. Fortunately for the girl, Neuropozyne worked quickly; she watched with satisfaction as Sofia’s seizures eased and she fell into a true sleep.
Sloane stood, shoulders taut with anger, but Jensen beat her to the question. “Why didn’t she get her dose on schedule?” he asked, in a voice like an Afghanistan road. Marya’s response came as a fast spate of Czech. Jensen looked like he was having some trouble parsing it, so she provided a brief summary.
“Marya’s husband sold Sofia’s Neuropozyne, probably for a nice profit. He figured she could get by on Riezene, it’s a lot cheaper, only the supply dried up because it was tainted. He said he’d take care of it, went out of town on business and never did.” Sloane was quietly, transcendently, enraged. It was bad enough that people preyed on the augmented, but when it was a child… “And they call us monsters,” she breathed. Her eyes leveled on Marya’s like gun batteries on a target, and whatever Marya saw in Sloane’s face made her take a step back.
“I just—I thought one of you would have some to spare, especially for a child. I—I can pay…” Marya pulled out a credit chip with one well-manicured hand and held it about two inches from Sloane.
Sloane’s hand darted out, not to take the chip, but to wrap around Marya’s wrist in a carefully metered grip. “Look around you,” she snapped. “Look!” She gave Marya’s arm a short, sharp shake of emphasis. “Do these people look like they can spare anything? Or that they’d waste it on someone who only sees them when they become convenient?” Marya’s face showed only blank incomprehension. Sloane shook her head in disgust and released Marya, snatching the credit chip as she did. “You’re lucky that I’m not willing to let a little girl suffer for the cruelty of her parents. This,” she all but slapped the vial into Marya’s hand, “at Sofia’s weight, should last about two months with weekly injections. Don’t let your husband find it—you won’t get any more from me.” She bent to lift the sleeping girl into her arms and paused to pin Marya once again with her glare. “I wouldn’t wish Golem City on my worst enemy, much less a kid. That’s the only reason I’m not reporting you to Child Welfare.” With that, she gently returned Sofia to her mother.
Marya fled, her daughter clutched in her arms. Sloane sank down on the edge of the fountain, rubbing her hand over her eyes. You can’t save everyone. She sighed heavily, then turned her attention to her erstwhile assistant. “Thanks,” she said, quietly. “Most people around here run away from screams.”
Jensen picked up his coat, brushing off the detritus; she took the opportunity to study him. Six foot one, 180 pounds, eye, arm, and neural augs. Probably more that I can’t see. Study quickly became appreciation—tall and lean, with an Apollonian physique, he had the taut poise of a dancer and the leashed energy of a raptor on the stoop, and the dark of his hair and hands were a vivid counterpoint to his pale skin. Get a grip and stop staring, she chided herself, and gestured at his coat before he noticed. “Hope it didn’t take any damage?”
He shook his head. “It’s fine.” He gave her a sidelong look, opaque behind the shields. “What you said—can you?” At her puzzled look, he elaborated. “Spare it—the Neuropozyne.”
Sloane chose her words carefully; it wasn’t wise to admit to having too much Neuropozyne in reserve, but people needed to know they could rely on her in an emergency. It was a delicate balance. “I’m okay. I can usually get my hands on a little extra for emergencies. Comes with the package; it’s almost impossible to get emergency services or a real doctor to help around here, so I do what I can. If you ever need it.”
“Ah. That’s—good to know,” he said, awkwardly. He looked in the direction of Marya’s retreat. “That sort of thing happen often?”
Sloane shook her head. “No, it’s usually pretty quiet. We’re close enough to the metro that the police presence keeps a lid on things. For good and ill.” She slid back to her feet, settling the trauma bag on her shoulder in a practiced motion, then offered her hand. “Sloane Delacourt.”
He hesitated a moment, then returned the handshake with a gold-filigreed grip as precisely metered as her own. The usual sizzle of two electromagnetic fields impinging on each other was little more than a pleasant tingle down her fingers, a sign that his augs were finely tuned and well-shielded. “Adam Jensen. I just got transferred here.” Sloane noted the vagueness of the answer, combined that with the unmistakably high-end tech and all the little subtleties of body language that screamed that he’d seen action, and figured him for corporate security, probably with the kind of NDA that involved ten-millimeter retirement. In Sloane’s experience, corporate security types weren’t known for their humanity—they were pretty much mercs with a steady paycheck—and yet, he’d gotten involved, risked something precious to him for the sake of a child.
The dichotomy intrigued her enough that she gestured up to her apartment. “I’m in 33; since I know you’re heading in that direction anyway, can I offer you a cup of coffee? Fresh-ground.”
Jensen stared at her for a moment, then seemed to withdraw into himself. “Some other time, maybe.”
Sloane didn’t take it personally. “Sure thing.” She gave him a grave nod. “See you around.” This time she took the stairs; she had a long day ahead of her.
Notes:
The Church of Our Lady Before Tyn:
https://en.wikipedia.org/wiki/Church_of_Our_Lady_before_T%C3%BDn
Chapter 3: Check My Vital Signs
Summary:
Adam tries to settle in to his new home in Prague, but is haunted by ghosts of past and present.
Notes:
Revision posted September 26, 2021
More introspection! More backstory!
Chapter Text
PRAGUE: MARCH 2029
Adam Jensen sat in a makeshift clinic in the sewers of Prague and tried not to pay attention to the young man burbling excitedly about the genius of David Sarif. The Collective had sworn that Vaclav Koller was the best person for Adam’s needs—not to mention the only person Adam could get to with any reliability—but Adam was finding Koller’s enthusiasm a little wearing. He leaned his head back and found his thoughts drifting to the events that had brought him here.
Undercover missions had never been his forte, but when TF29 had needed someone to infiltrate the Pent House, a maximum-security prison for augmented people, he had been the obvious choice. It had been a risk; the biochip the prison facility installed to suppress his augmentations had given him blinding headaches with every breath. Worse, it had left him feeling like he was slightly out of sync with everything around him—like nothing was quite real. Even now, he delved into those memories only reluctantly.
The prison had been a morass of corruption from top to bottom. Nothing it touched had come out clean—not even him. He’d made deals with prisoners, with the warden, with anyone he had to, all for the sake of the mission. He hadn’t caused the riot, but he’d helped it along, and innocents had died with the guilty. He’d gotten the intel from Guerrero—or should it be Mejia?—but it hadn’t been conclusive, and the alleged threat had been a non-event, so what had been the goddamned point?
Adam’s free hand rubbed the hexagon at his temple. Guerrero/Mejia had shaken him. He’d seen his share of corrupt cops, and he’d always been firm in his own conviction that he wasn’t going to cross that line. Now that he was living a double life, he was beginning to see that it wasn’t so easy. Nor would it get easier. Easier would have been staying with the North American team, where he knew the ground and the players—but that hadn’t been an option.
No sooner had the Pent House’s control biochip been removed than he’d been informed of his upcoming transfer to the Central European division. Jarreau had not been happy about it. The two had shared a quiet smoke on the roof, well away from prying ears. “Prague’s about the last place I’d have sent you,” Jarreau said, in his Louisiana drawl. “It’s the front lines of the anti-augmentation movement. Putting someone like you in the middle of that—well, it’s a powder keg, and I’d hate to see a good man like you become the match.” He took a deep drag on his cigarette. “On the other hand, if that’s where you’re needed, who am I to question the wisdom of the PTB?”
“A field agent,” Adam had deadpanned, getting a wry laugh from his now ex-boss. He’d been with the L.A. team less than a month, and he already missed it. Jarreau hadn’t let the classified details regarding the train op slip, but he’d made it quietly clear to his people that Jensen’s intervention had averted a disaster, and that their comrades hadn’t died in vain. That mattered to people like these. It had eased his way, and he’d been quietly grateful.
The Prague office was an entirely different matter. Bad enough that, while he was officially working for the head of the Counter-Terrorism unit, he could also expect to be used in a solo capacity by the Prague unit’s director. It made for a muddled chain of command, and Adam could already tell that it would cause trouble. What was the old saying, “No man can serve two masters?” Add in the Collective, and Adam had three. Lucky me.
Adam belatedly realized that Koller had asked him a question. “Hmm?”
“I said, does it hurt when I do this?” At Adam’s headshake of negation, Koller grinned. “Excellent.” He made some minute adjustments to Adam’s arm, talking excitedly all the while. “Okay, so now I am going to show you something that is really neat!” He shifted the forearm so that Adam could see the long, ugly scratch that marred its “skin,” exposing the underlying metal. “Sarif tech is so fucking amazing, man. Check this out.” He began to rub a bar of something gray and greasy-looking over the scratch.
“What exactly are you doing?” Adam asked, a little sharply.
“Ahh, it’s just graphite, you gotta learn to trust me! I would never do anything to hurt these beauties!” Koller shifted the arm a bit so Adam could see more clearly. “Do you even know what this is?”
Adam sighed; he really didn’t want to talk about it, but he also recognized that there was no stopping Koller. “Some sort of polycarbon, I think.”
“No, no, my friend, that is like calling a Maserati just ‘a car’. This is,” he paused dramatically, “a self-healing, non-Newtonian carbon nanoweave!”
Adam just gave Koller a look. Unfortunately, the effect was muted by his eye-shields. “I think I recognized about three of those words.” It was an exaggeration, but playing ‘dumb grunt’ was useful in either getting someone to explain more clearly, or if possible, to shut up. Given Koller’s enthusiasm, he resigned himself to the former.
“Okay, okay, okay,” Koller stepped back, waving his arms energetically. “So, self-healing is a tiny exaggeration, but give it an application of particulate carbon—you could probably even get away with the soot off a fireplace, but how low-rent is that?—and the nanoweave uses the carbon to repair itself. That’s so awesome!” Koller actually pumped his arms and did a little dance to emphasize its awesomeness. “And look, if you press gently, it deforms, a lot like organic skin. But hit it with any force,” he demonstrated with a brisk tap, which bounced off a suddenly rigid exterior, “and it hardens up. Non-Newtonian! These Sarif 7s are really sick—how do you even get them, I’ve seen exactly two sets! I don’t think they ever hit the open market!”
Adam’s attention snapped back to Koller. To the best of his knowledge—which, granted, was over a year out of date—the S7s were a one-off, custom-designed for a single individual… who happened to be one Adam Jensen. He couldn’t think of anyone else for whom Sarif would have built the S7s—unless it had been Sarif himself, but milspec—even gold-accented milspec—didn’t fit Sarif’s personal style. His skin crawled. There was an entire year that he couldn’t account for, a gaping hole in his memory. Had someone copied his systems while he lay comatose and helpless? The thought made him feel sick and violated.
He struggled to control the fierce desire to find something—anything—that would shed light on that echoing void, knowing that he couldn’t just demand answers, no matter how desperately he needed them. He had to tread gently; not only did Koller still have his arm opened up in front of him, but the slightest whiff of ‘authority’ would make the kid clam up. Somehow, he managed to school his voice to relative calm. “It was a pretty limited run, as far as I was aware.”
“Limited? Try fucking minuscule! And you can tell they’re a custom job, the way the proportions are so perfectly matched, the way the inlay matches her hair, it’s one hundred percent top-end Sarif, man!” Koller grabbed theatrically at his hair. “There’s nothing like it coming out of China; it’s like all that Sarif tech vanished when Tai Yong bought them out!”
Koller didn’t know how right he was. Most of the last of Sarif’s tech had gone up in flames near the Canadian border; anything else had disappeared through the efforts of a certain nasal-voiced ponytailed pain-in-the-ass hacker. Tai Yong Medical may have stripped Sarif Industries for all its assets but I was under no obligation to make it easy to get to them. Adam stuffed the memory back down into its box; he and Pritchard were done with each other. He certainly didn’t miss him.
Fortunately, Koller hadn’t even noticed his distraction. “—you should talk to her, she’s the one that showed me the graphite trick!”
Well, that was an opening large enough to drive a tank through. “It would help if I knew who I was supposed to be talking to,” Adam pointed out, drily.
“Doc Delacourt, right across the way! Comes over and helps out if there’s a problem on the organic side. Though she won’t let me dig into her augs, either.” Koller pouted as he closed up the panels on Adam’s arm. “Okay, flex that like you did before—perfect!” The tech moved around behind him. “Okay, now I need to access your cranial augs; I want to make sure that control chip you mentioned didn’t cause any degradation to your neural hub. So you’re going to have to keep your head very still, otherwise I am going to have to give you the gas.”
“I’d rather you didn’t put me under on the first date,” Adam said. He found a comfortable position for his head. “How’s this?” He took a deep breath and settled into stillness. Even during his SWAT days, he’d held less comfortable positions for longer; now, with his augments, it was child’s play.
“There is no trust,” Koller said sadly. “I get it, I get it, outside it’s all jackboots and truncheons, but here in the dungeon, we are all about trust. You can even pick a safe word if it would make you feel better.”
Adam wondered if Koller’s ‘Doc’ was the ‘Sloane Delacourt’ he’d met the day he moved in. “You were telling me about the doc,” Adam said carefully, moving his jaw as little as possible.
“Right! All that gorgeous hardware, and brains to match! She can stop a bleeder in no time flat! Not my type, though, I am not so much for the warrior women.”
“Warrior women?” Adam repeated with some amusement. He was rapidly getting the impression that Koller could keep a secret if you made it clear to him that it was a secret, but he otherwise seemed to be completely lacking a brain-to-mouth filter. The innocence of youth, perhaps. It was oddly... refreshing. He made a mental note—if he needed gossip about the area, Koller might be a good starting point.
Koller chattered on as he elicited strange sensations from Adam’s neural hub. “Well, I asked her where she learned to sew someone up like that, and she said something about being kicked out of planes for the Army. Which I am presuming is the American army.” Koller fell silent while he focused on his readouts, but Adam had plenty to occupy his mind. He’d stamped Delacourt’s image into his memory—he still had the reflexes of a beat cop—and it was easy for him to call it up. 5’11”, short copper hair, athletic build, with a strong but not overwhelming handshake. She wasn’t beautiful, but she had a leashed energy that drew the eye, and a hypervigilance that Adam recognized from personal experience. And definitely fitted with Sarif augs; he’d recognized the way her hand had split open and reconfigured—just as his hands did.
“Oh, aaaaaaaand she doesn’t take any shit from anyone.” The tech’s head slid, upside-down, into Adam’s field of vision, like some weird jack-in-the-box. “Someone tried to grab her ass in the store, and she broke his hand, just like that!” He snapped his fingers. “It was the augmented hand, too. Asshole tried to get me to fix it for free, but fuck that!” Koller receded back out of sight. “Okay, that all looks good, you can move again.”
Adam stretched himself up out of the chair. Or, as Koller put it, The Chair. “So, we good?”
“If you’re not going to let me get a better look at those beauties…” Koller gave him a look that couldn’t help but remind him of Kubrick begging for treats; Adam just shook his head, and pushed down a pang of sorrow at the memory.
“Maybe later.”
“Okay,” Koller sighed. “I didn’t see any damage to your neural augs, which is really good, man. Those fucking TYM control chips, sometimes they aren’t too careful with the amperage. But all your systems look like they’re running fine.”
“Good.” Adam nodded. “That should be enough of a baseline for anything I need in the future.”
Koller shrugged. “Sure, man. You expect to be here often?”
Adam considered the direction his life had taken. “Yeah. Yeah, I do.” He gave Koller a second polite nod, turned, and left.
Adam wandered through the streets of Překážka. The only place he had to go was an apartment that he was uncomfortable in. It wasn’t that it was unfamiliar—it was that it wasn’t unfamiliar enough; there was just enough similarity to the old Chiron apartment that he felt slightly wrong-footed. He knew the feeling would pass with time, but he wasn’t prepared to cope with it right now. Instead, he decided to get the lay of the land.
Prague was an old city. Detroit had been a city in collapse, feral and desperate, the last gasps of a city that had grown too fast, given too much, and then been abandoned to a premature collapse. Prague, on the other hand, had endured in one way or another for two thousand years, had recreated and renewed itself through the ages. Even now, he could see the face of that renewal in small things, like a Chinese restaurant in a Renaissance-era building, and in large, like the neon-lit Palisade Blades, bright against the ribbon of the Vltava. Prague had been wounded in the Incident, but it refused to die; even so, against fire and plague, Huns and Hussites, Crusaders and Habsburgs, Nazis and Stalinists, it had refused to die. Prague would heal, if the people behind the Incident would let it. Adam felt a strange sort of kinship with the city’s relentless struggle; if it weren’t for the rabid anti-aug oppression, he thought he could find a place here. At least, as much as he was allowed.
Adam couldn’t shake the feeling of dislocation that had plagued him since—since he’d woken up in a concentration camp for the augmented, a bare three months ago. He knew what was causing it, of course. Somewhere in the depths of Panchaea, he hadn’t just lost a year of his life—he’d lost himself. Or had it been earlier? When he followed Megan’s trail across two continents, only to find he’d never really known her? When he was torn apart by bullet and scalpel and reassembled as a goddamned war machine, all polymer and metal? When he had realized just how many secrets the people he’d trusted—people he’d loved—had kept from him? The pieces of his life were scattered through time and space, and he wasn’t sure how they all fit together.
And here he was, a double agent, on one hand combating terrorists as an agent of Interpol’s Task Force 29, on the other, attempting to ferret out the Illuminati’s secrets for the Juggernaut Collective. Adam paced the streets of Prague and wondered: between the agent and the spy, was there room for him to find just plain ‘Adam’? Who would he see when he looked in the mirror?
His earlier ruminations caught back up with him, and the sharp features of a man caught between selves intruded into his thoughts despite his efforts to banish it. Who had he really been, there at the end? Did Guerrero exist now as anything but a ghost in Mejia’s memory? How deep could you go before you started losing yourself? Mejia was an answer Adam refused to accept. Couldn’t accept, not and stay himself and sane. He’d feed almost everything into the devouring maw of the mission if he had to, but if he lost his humanity, he’d become just another pawn of the ones he fought.
His meanderings had brought him around to the metro station. He bought a fresh pack of Royal Hellhounds from a nearby kiosk, lit one up, and drew the familiar harshness of the nicotine into his lungs. It faded too quickly, as his lung augmentations filtered out the toxins, but it was enough for him to grope at some remembered connection to himself. Maybe he just needed time.
McFadden had said much the same: “Don’t try to force it. Just let the rest come in its own time.” And to some extent, he had been right; Adam was fairly confident that his memories of his life before Panchaea were as complete as they had ever been. But anything beyond that, until the time he woke up in Alaska, remained a void. He’d been told he’d been comatose, and yet he had the sense of something monstrous in that darkness, squatting like Grendel just beyond his reach. The—he couldn’t really call it darkness; it was more of an un-light, not an opposite but absence—seeped into his dreams. He dreamed—knew he dreamed—and yet, when he woke, there was only the yawning chasm that left him unwilling to return to sleep, pacing the floor, seeking a way to drive the shadows back for one more day.
Which, Adam acknowledged to himself, he was doing now, and without any real success. It didn’t help that he was feeling the lack of routine; TF29 had already had to push back his onboarding once, thanks to problems getting the necessary permits. He always got introspective when he didn’t have anything else to occupy him.
Rescue came from an unanticipated source. As, for lack of a better idea, his steps turned in the direction of his apartment building, he felt the familiar tingle of the infolink. Vega’s picture popped up on his HUD. “Got a minute, Jensen? Thought you might like the low-down on your neighbors.”
Adam took another drag on his cigarette before responding. “You telling me you did background checks on the other residents? Isn’t that a bit overkill?”
“You’re a valuable asset, Jensen,” Vega replied. “The least we can do is keep an eye on you.”
Well, at least he knew where he stood with the Collective. “Point. Okay, shoot.” He leaned against a reasonably clean patch of wall to work on his cigarette while Vega filled him in. Ordinary people, by and large: a dancer turned bartender, a father and daughter, an elderly social worker, a computer architect, a cat-loving recluse. An arms dealer on the second floor, unaffiliated with any of the local gangs—Adam made a mental note; he might be useful. And then…
“…and the apartment below you is in the name of a T. Shrike. Leads back to a law office; we’re still working on that one.”
Adam blew out a lungful of smoke. “Sloane Delacourt. Met her my first day here. Look for associations with the U.S. military.”
Vega chuckled. “One day and he’s already meeting the girls, the boy’s hot! All right, I’ll see what I can come up with before I send it off to the rest of the JC.” He pulled out a second cigarette, considering what little information he had. That she had Sarif augmentations was unmistakable, but that wasn’t itself a reason for suspicion, if she had been in the US Army—Sarif had been the primary supplier for the American military enhancement program for over a decade. Koller could have misidentified the augmentations in question; his expertise was in Chinese tech. Adam told himself he was jumping at shadows, but there was something in the back of his thoughts that wouldn’t let it go.
He was lighting a third cigarette when Vega came back online, sounding significantly more sober. “Jensen—we might have a problem here.” She paused, then added, “Look, how much do you know about the Illuminati?”
Adam sighed. “Just tell me, and I’ll let you know when you hit something that I do know.”
“Fair enough,” Vega replied. “The Illuminati goes back a long way, and they still have some very—feudal—attitudes. Including—the best way I can describe it is that some of the most prominent families among them have, well, retainers. And the name ‘Delacourt’ comes up as a name repeatedly associated with the DuClares. Up until last year, a Violette Delacourt was working as Elizabeth DuClare’s right-hand woman at the World Health Organization.”
That was a name Adam knew—Elizabeth DuClare had been all over Picus News just before the Incident, encouraging people to get their biochips updated. “Okay. So, coincidence or connection?”
Vega was quiet for another long moment. “Could be ‘connection’. I’ve got a Sloane Delacourt, late of the U.S. Army Medical Corps, daughter of Violette and—huh, that’s weird. No father of record anywhere, not even on her birth certificate.”
In this day and age of ubiquitous DNA testing, that was almost unheard-of. It made Adam’s cop instincts twinge. “Yeah, that’s odd.” He scratched meditatively at his beard. “Any record of combat injuries or MEP in her background?”
Vega’s response was immediate. “No, why?”
“Because she’s augmented, eyes and arms at least. Can you find me a paper trail on her hardware?” The mystery S7s still preyed on his mind.
Vega sounded startled. “Uh, I can try? Why do you want to know?”
Adam didn’t trust Vega enough to tell her the truth, but he’d come up with an explanation that she should find plausible. “They’re high-end Sarif augs. Maybe she’s got a connection to the guys trying to steal the Sarif weapons from Detroit a couple months ago.”
Vega hissed in understanding; she’d been there for the aftermath of that near-disaster. “Oh, hell, yeah—if we can prove a connection on this end, that would make some people very happy. Lemme see what I can find.”
Adam had time to get takeout for dinner before Vega got back to him. He spent more time pushing it around the plate than eating, and eventually just shoved it in the fridge for later. Finally, her voice crackled back over the infolink. “So, no paper trail that I can find. Obviously, I can’t follow up on the Sarif end…”
Adam didn’t need a rundown on the fall of Sarif Industries. “Yeah, figured that.”
Vega continued, “So I had to try the other end, but the clinic where the work was done—in Prague—burned down in the riots last year. Most of the staff was caught inside.” Adam winced. He’d seen a lot of ways to die, but to be burned alive was one of his darker nightmares. “The interesting thing there is that it was a private clinic, owned and operated by Violette Delacourt.”
“The mother,” Adam said. “I thought LIMB had a monopoly on augmentation surgery.” Even Sarif had gone to the nearby LIMB clinic for the surgical experts that had… saved his life.
“They did, mostly. But if Delacourt senior was working with DuClare, she was probably on the LIMB books as an official contractor. All we have are fragments of data that suggest that your Delacourt was augmented not long before the Incident. Coincidentally around the time her records say she was discharged. Other than that, it’s a dead end.” Vega trailed off.
“Convenient. She gets augmented, and then the clinic burns down, taking the paper trail with it. Fits with the way the Illuminati likes to use dead bodies to hide things,” Adam concluded. So what are you hiding, Sloane Delacourt? She’d impressed him with the compassion and steel with which she handled the situation in the courtyard, and she’d seemed friendly enough afterward, but he couldn’t trust anyone’s motives. Especially not a stranger with ties to the Illuminati.
“Yeah,” Vega agreed. “On the plus side, she’s owned the apartment for about a year, so unless the Illuminati has developed the ability to see the future, she probably isn’t here for you.”
“But she could be here for the task force,” Adam decided. “Too much smoke, not enough fire. I’ll see if I can’t do some digging once I get settled in.”
“Roger that,” Vega said. “If you find anything interesting, pass it on to me.”
“Yeah,” Adam said thoughtfully. And, he thought, he’d be the one to decide what was ‘interesting’. He didn’t trust the Collective as far as he could throw them, but for his current purposes, they were the only game in town. “I’ll do that.”
Chapter 4: The Girl I Never Knew
Summary:
David Sarif reaches out to the daughter he's never known, and finds out that she's more than he bargained for.
Notes:
Updated October 3, 2021
Now with bonus content!
Chapter Text
BOSTON: APRIL 2029
David Sarif idly paged through the information on his desk display. He didn’t need to pay close attention to the contents; he’d been compiling the dossier for almost thirty years, and was intimately familiar with its contents: the life of his daughter, observed from afar, recorded by proxies. He’d had no other way to know her. Her mother had taken her out of the country, and out of his life, days after she’d been born. It had taken him five years to track them down.
David still didn’t know where he’d gone wrong, but he’d flown to France anyway. He hadn’t expected to be pulled out of line at customs and escorted to a small meeting room. Violette had been waiting for him. They sat on opposite sides of a government-issue table. She was flanked by a pair of lawyers whose bearing and dress screamed ‘wealth’ and ‘power’. They hadn’t said a word. They hadn’t needed to. David was flanked by a pair of customs guards. They hadn’t said a word. They hadn’t needed to. It was clear who had the whip hand in this room.
“You have no legal rights to her,” Violette explained, in the soft, French-accented cadences that he had once loved. “We were not wedded, and you are not named on her birth certificate. She is my daughter.”
“For God’s sake, a DNA test would prove my paternity!” Frustration and anger sharpened his voice.
“You may attempt it,” she said. “But you will not like the outcome.” She regarded him like she would a particularly recalcitrant tissue sample. “What is true and what can be proven are two different things.” The implication was clear: Violette would tie up any paternity suit in the French courts (which were not kind to foreigners on a good day) for years; she might even go so far as to tamper with DNA test results. The game had been rigged against him before he’d even realized he was on the board.
“Look,” he said, “whatever it is you have against me, she shouldn’t suffer for it. She deserves a father. Even a long-distance father. I just—I just want to make sure she’s okay. That I’m there if she needs me. She’s my daughter too.”
Violette tapped an immaculately-manicured fingernail on the table. “I think that would be unwise. Her future has been planned, David; I will not have you interfering.” Again, that uncomfortable scrutiny. “But otherwise, you’ll continue to be a thorn in my side, won’t you?”
“I’ll fight for her,” David replied. “Even if it’s a losing fight.”
“Yes,” Violette actually sounded exasperated. “You never did know when to give up gracefully. Very well. I will not allow you direct contact with her; you meddle. But you may send observers who can report back to you, and I will not interfere with them—provided they do the same.”
David considered his options. He could fight her, challenge her in the courts. But in the end, he’d lose; the time and money invested would be wasted, and his work—his dream, the one he was building with Hugh—would suffer.
David stared her in the eyes; he refused to look like he’d been defeated. It was sheer defiance that made him demand, “And you’ll tell her about me. She has a right to know.”
Violette’s smile didn’t reach her eyes, and he wondered how he’d ever thought she loved him. “When she is an adult, capable of understanding.”
David had returned to Boston and his research—he was working with Hugh Darrow, for heaven’s sake! He told himself he’d made the sensible choice. Even if, by some miracle, he managed to win against Violette, what could he offer a child? All his money and time was tied up in his work. As unpalatable as it was, it was probably for the best; he hired the best investigator he could afford, and, no matter what he was involved in, always carved four hours out of the last Friday of every month so he could bring himself up to date on his daughter’s life. For years, it had been enough to salve his conscience.
David sighed and dismissed the collage of photographs and reports with a wave of his hand. At some point, it had stopped being enough. All the pictures, the records, the interviews, the heavily-redacted after-action reports—it didn’t make up for the years he’d lost. Funny, how he’d never really noticed how much it hurt until after he’d lost everything else. Until he’d almost lost her, before he’d even had the chance to meet her.
The news that his daughter had been critically wounded in a training accident had come at the worst possible time. SI had been reeling from the second attack in six months, Adam had been in transit to Hengsha on the trail of a ghost, and David could not drop everything to go to her, no matter how much he’d wanted to. That didn’t mean he was helpless—he’d seen with Adam how far one could go to keep someone alive, and he would give his daughter the same chance.
He’d used his military contacts to replace the Army-standard augmentations with the ones he’d kept updated over the years, just in case: custom-built, top-of-the-line, and carefully chosen to suit her profession. In addition—he’d done the math—her injuries were extensive enough that she’d be risking Neuropozyne toxicity. The loss of Megan’s team had meant he couldn’t fully equip her augmentations with X1 biochips, but he’d personally (and secretly) used the last two experimental models as the primary cranial and spinal mounts. By his estimates, her Neuropozyne dose would be decreased by at least twenty percent.
He’d arranged for the substitution, and then he’d had no time for thoughts of anything beyond the immediate crisis. And then—Panchaea. Goddamnit, Hugh, what were you thinking? It was right there in my hand, you could finally be part of your own dream! He’d nearly died there—his minisub had been found, days later, powerless and drifting. He’d been comatose for months—long enough for his company to be bankrupted and sold out from under him.
In the span of a year, David had lost almost everything: his company, his dream, his people; he’d come close to losing his life, closer to losing his daughter. Oh, he still had a small fortune, but it was cold comfort, set against all that he’d lost. He needed—he needed to reach out to her. Needed to know that he still had something worth living for.
He’d hoped that after his daughter had fully recovered, she’d contact him, but to his disappointment, months went by in silence. Only recently had it occurred to him that Violette might never have told her the truth—in fact, vindictive as she had been, that was very likely the case! And that meant, now that Violette was dead, there was nothing preventing him from speaking up himself.
Nothing—except his own uncertainties. Would she hate him? Blame him for abandoning her as an infant? If the reports were right, her relationship with her mother had been difficult—would she resent any expression of parental interest? David simply couldn’t predict how she’d react, and that left him unusually uncertain—a state he had little experience and less patience with. He leaned back in his chair, tossing a baseball gently up and down, finding comfort in the familiar rhythm.
“Just make the call, David,” he muttered to himself. “There’s no point in putting it off.” His fingers closed around the baseball and set it gently on the desk as he checked the time—1:30. He had a meeting at 2; thirty minutes was surely enough for a first conversation, and a looming deadline offered a graceful means of escape if necessary.
Her smart home answered the call; he was already shifting mental gears to leave a message and move on when, abruptly, the outgoing voicemail broke off and the connection went through. He was so surprised, all he could do for a moment was drink in the sight of her.
She was broader across the shoulders than he’d expected. It hadn’t been quite so noticeable in the pictures; maybe it was the uniform, or that she was usually surrounded by larger, stronger men. Here, she looked somehow more—imposing. Her short hair was a vivid light auburn, the product of some genetic alchemy, as if Violette’s strawberry blond had catalyzed with his into a more intense shade. The eyes, though, the eyes were recognizably his. Was it as odd for her, seeing her eyes in a face not hers, not a mirror's reflection but something more indefinably organic? (And yet not organic, because his eyes, like hers, were retinal implants, but they were still the same color. He’d chosen them himself, the precise gray-hazel he saw in the mirror every morning, only distinguished by the ring of copper rather than gold.)
He couldn’t help a frown at the faded scars that marred her cheek—those almost looked like shrapnel wounds. It must have been one hell of a training accident. And even so, the scars didn’t blur the underlying character in her face. She had his grandmother’s jaw, strong and stubborn, and he absently wondered if she’d inherited the legendary temper that had accompanied it. The cheekbones, high and sharp, could have come from either parent, but the dimple in her chin was definitely a maternal inheritance—as was the straight Grecian nose. He was absurdly glad she hadn’t inherited his beak of a nose; it would have turned a strong face, full of character, into something much harsher.
God, he did good work, biological and mechanical.
His daughter raised an eyebrow as he stared at her in silence, and when she spoke, it was in a slightly rough contralto. “Yes?” She seemed unruffled, as if she had tech billionaires calling her up on a regular basis, but his CASIE identified the subtle pupillary dilation and faint shifts of body weight that suggested she was just as nervous as he was.
“I,” he said, and paused, because just how was he supposed to say “I’m your father…” without making it sound like an old movie reference? “I don’t know if you know who I am…”
She brushed her hair out of her face. “You’re David Sarif,” she said, meeting his gaze. She looked away for a moment, then back. “My biological father.”
David took a deep breath. “Violette told you?”
The young woman shook her head. “I found out after she died. It was on the genetic augmentation compatibility tests.” She tilted her head, examining him with a cool distance reminiscent of her mother. In a carefully neutral tone—though his CASIE registered the tension underneath—she added, “Of course, neither did you.”
It took all his self-control not to wince. “No. The situation was…complicated.” The baseball was back in his hand. “She was supposed to tell you when you were eighteen, let you make your own decision. Obviously,” he turned the baseball around and around, “she didn’t.”
“We weren’t on speaking terms back then,” she said, flatly; it was clear that was a sensitive subject, and one she wasn’t interested in pursuing.
An uncomfortable silence fell for several moments; it was David that finally broke it. Tentatively, David said, “I…suppose she never said anything about me…”
A terse headshake. “No. Obviously, I knew I wasn’t the product of a virgin birth, but it wasn’t a topic for discussion beyond the bare minimum she gave me.” She hesitated, then added, reluctantly, “She said it was an accident. And that you weren’t interested in having a kid.” She muttered under her breath, “…as if she was…” That last was clearly not meant for him, and he decided he was likely better off pretending he hadn’t heard it.
“That’s—as I said, it was complicated, but…” He tossed the baseball up and down a few times, gathering his thoughts. “I’m not entirely comfortable speaking ill of the dead, but I’m also—it wasn’t—it didn’t end well.”
Her mouth twisted in a sardonic smile. “I know what my mother was like. On doit des égards aux vivants; on ne doit aux morts que la vérité.” He was familiar enough with French to recognize the Voltaire quote; it surprised him, suggested a sophistication he hadn’t expected from a career soldier.
Sarif nodded, slowly. “The truth? I’m not certain how much of an accident it was. But—when she told me she was pregnant, I wanted you. I wanted to be a father—your father.” He rubbed one gold hand across his face. “And I probably would have been terrible at it. I wanted to change the world. That’s not usually compatible with a family life.” The baseball went thump, thump in his hand. “And I thought she felt the same. We’d have made it work, and I certainly wouldn’t have expected her to give up her career—I wanted her to be my partner. She… complemented me. She just had to finish her surgery fellowship, and she’d have done the work on the biological side, while I focused on the engineering. We could have done such great things together…” The ghost of that long-ago pain reached up and clenched his heart. “But not long before you were born, she—changed. It seemed like she had some sort of agenda she wouldn’t tell me about. She was pushing for funding sources, research projects that I wasn’t comfortable with—too many strings, ethical issues… We—I can’t say that we had arguments, because she just—wouldn’t engage, wouldn’t listen, she just went on as if she was right.” He could see from the look on his daughter’s face that she’d run into that herself. “The day you were born, she gave me an ultimatum: start doing things her way, or I’d never see you again.” He sighed. “I was on the fence. If she’d given me a little more time, I probably would have given her what she wanted. But she wanted me to decide right then—her way or no way.” He spread his hands helplessly. “So, she did her best to erase any indication that I was involved in your birth. She even changed your middle name.” At her look of surprise, he clarified. “It was supposed to be Salome, for your great-grandmother.” The same one whose jaw she’d inherited.
Her eyes widened, and she made a noise that sounded like she was choking. “Salome? Jesus, did either of you ever go to public school?”
David couldn’t help but laugh. “I admit, we weren’t really thinking of that at the time.” He was suddenly reminded of something he’d wondered about—she seemed to use her initials on anything requiring a signature. “Ah, can I ask which name you prefer—”
“‘Sloane’,” she said firmly.
David nodded. “Sloane…” He rubbed his hand over his face. “I know I haven’t been part of your life up until now, and I’m not here to interfere.” Much. Unless there’s something you need. “I just…I wanted you to know. And, if you're willing, to get to know you a little better. Maybe establish some sort of relationship.”
Sloane tilted her head curiously. “Are you the reason I ended up with a king’s ransom in augmentation hardware?”
He nodded. “I wouldn’t put it that way, but…yes. I, ah, found out that you were hurt, and…”
“These are custom jobs,” she observed. "This never came off a production line."
David had never been able to contain his enthusiasm when it came to his creations. "Mass-market? For my daughter? Absolutely not! Most of the internal components were part of a specialty run I'd done a couple months before, and I cast the outer shell of the arms and legs to precisely match your own biometrics. Built to military specifications, of course, I didn’t expect you to retire from the Army..."
“It wasn’t my idea,” Sloane’s voice was dry as dust. “I guess after the Incident they thought I was a security risk.”
“There was a lot of that going around,” he sighed. “But with your skills and augs, you shouldn’t have any problems finding work; there’s Dynacorp, Ironflank, Sharp Edge…”
“No.” She folded her arms behind her back in a military-looking posture. “I won’t work for mercenaries. I’ve spent too much time cleaning up what they leave behind.”
“Surely, that limits your options,” he said. “The restrictions on people with military augmentations—”
She gave him a challenging look. “Are you thinking of taking them back?”
“What?” David yelped. “No, of course not, I wouldn’t do that!” He was off-balance again; the conversation wasn’t going the way he’d expected.
“Good. I’m coping with the restrictions, and I’ve got some feelers out for jobs that won’t make me want to scrub my skin off with bleach. I’m not worried yet; I’ve only been running at one hundred percent since about the turn of the year.”
That, in David’s experience, was a remarkably short recovery period. The only person he’d seen recover faster was Adam, and he was special in so many ways. Of course, he’d ensured that she had an advantage. “You’re fully recovered, then? Usually it takes a couple years. Sometimes even three.”
Sloane shrugged. “Most people aren’t trained to push themselves through pretty much anything. I am, and I’ve rehabbed injuries before. I know my limits better than anyone else.” Again, that almost indifferent shrug. “Makes a difference.”
“Remarkable,” he breathed. “Absolutely remarkable. You’re even more impressive than the rep—than I anticipated.”
“Than the reports said?” She had a sardonic glint in her eye.
“Well, yes, but that’s hardly—"
She looked up at the ceiling, then back at him. “I’m not stupid, Sarif. Violette wouldn’t have asked you for help, which means that you were keeping an eye on me for your own reasons. Given what she was like, I’m even willing to grant that you had the best of intentions. And I’ve had security clearances, which were their own special kind of invasive.”
“Oh,” David said. “Well, I’m glad to see you’re being reasonable about—"
Her voice grew hard. “And it ends now.”
How dare she—! David’s eyes narrowed, and he said, in the kind of tone that sent most men running, “Is that an ultimatum?”
Sloane stared him in the eye, unflinching. He had to respect her for that, despite his outrage. “Call it a condition, if you like. You want a relationship with me, I’m willing to give it a shot. But it has to be an actual relationship, in which I have the choice to share things or not. You don’t get to be a voyeur into my life anymore.”
“It wasn’t like that!” he sputtered. “It was the only way I could get to know you!”
“Then,” she pointed out with ruthless logic, “you don’t really need it any more, do you?”
Sarif gritted his teeth. “You sound just like your mother.”
Sloane’s jaw set and the copper in her eyes glowed molten. Almost absently, David thought that he had the answer to his question, she had very much inherited the temper that went with the jaw. “The fuck you say,” she snarled. “This is my life, and you will respect it as such, and if you can’t handle that, then go the fuck away and that spot that says ‘Father’ on my birth certificate can stay empty!”
Pride threaded through his anger. There weren’t many people who could stand up to him like that. “Okay,” he said, holding up his hands in a placating motion. He could give it a try. If it didn’t work out, he could always start the surveillance back up again; he’d just have to be discreet about it. “Okay. You win this one.”
She took a deep breath, and the CASIE reflected the reduction in blood pressure as she controlled her temper. “I mean it,” she said quietly. “I had enough of Violette trying to pull my strings when I was growing up. I’m not gonna let it happen again.”
“I understand,” David said, as conciliatory as he could manage. “You’ve made yourself entirely clear. I’ll pull the surveillance today. My word on it.” It wasn’t as if he hadn’t been warned—Radford had said, right there in his notes, that she was one of the most stubborn people he’d ever seen.
Just as stubborn as Adam, he thought, and then a wild idea came to him.
“You know,” he said, as casually as he could manage, “if you ever need a hand with anything, there’s someone I know in Prague. My former security chief. He’s a good man—”
His secretary popped his head in. “Mr. Sarif? Mr. Brown’s on the line for your two o’clock…”
“Dammit!” Why had he thought that a mere thirty minutes would be enough? “Sloane, I’m sorry, I have to take this—”
She nodded. “You’re in the middle of your workday. If you want to schedule another call, I’ll make sure I’m available.” She tilted her head thoughtfully. “It was…interesting…to meet you.”
“We’ll talk again,” David promised.
“I’m sure,” was her dry response, and then she cut the call.
It was with an odd mixture of relief and regret that he turned back to business.
Chapter 5: Sore Afraid New World
Summary:
Sloane pursues a private agenda, and inadvertently uncovers a new threat from an old enemy.
Notes:
TRIGGER WARNING!!! This chapter contains graphic scenes of violence, blood, gore, the result of serious illness, insects, torture, and generally has a high horror content. If you're phobic, or if this is going to trigger you in any way, *please* jump to the bottom notes for a TL;DR.
Updated December 2021!
(See the end of the chapter for more notes.)
Chapter Text
PRAGUE: APRIL 2029
Sloane made her way through the Prague undercity with a sense of exhilaration. The abandoned LIMB clinic had been mostly untouched by the fires from the post-Incident riots; half-buried by its neighbor’s collapse, it had been abandoned as unsafe. She’d planned her raid on the building carefully, knowing that she’d only have one chance, and the result had been everything she’d hoped for. She’d barely gotten out when the unstable structure caved in—well, she’d planned for it, but planning could only take you so far, and she’d had reason to be grateful to augmented strength. She’d come back once it settled; the labs on the lower level were probably still accessible, and there might be some equipment she could use. But even if that weren’t the case, her duffel was satisfyingly full. It wasn’t all pharmaceuticals, though she had enough to ease the lives of a whole lot of people. Her real goal had been clinical records—specifically, records from the two weeks before the Incident—and she’d found them.
It was something that had been chewing at her for a year. Too much about the Incident didn’t make sense; if nothing else, the uncanny simultaneity of millions of people going mad should have set off alarms ringing louder than the bells of Notre Dame, but—nothing! She’d heard all the rumors—it had been a contaminated batch of pozy (the odds were vanishingly small that a drug reaction would hit that many people in exactly the same way at exactly the same time), or Humanity Front had released a designer virus (same, even if they’d been capable of it, which they probably weren’t), or that the construction of Panchaea had released something from the permafrost—and the only one of the rumors that was even close to plausible was the ‘alien signal from outer space’. A signal didn’t have to be extraterrestrial to come from space, and if that were the case, what came down had to go up. The speed of light was a constant; if it had been a signal, you could measure the minute differences in onset across a geographically diverse dataset and track it back to its source. And she intended to do just that. She’d spent over a decade hunting down terrorists big and small, and whoever was behind the Incident…she had a feeling that they were the biggest terrorists she’d ever gotten her teeth into. And that meant that they were correspondingly dangerous.
Sloane grinned to herself as she made her way through “la gruyère”, the warren of storm drains, sewers, and buried medieval streets that made up Prague’s underground. If the game were easy, anyone could play. She’d become familiar with the undercity in the time she’d lived here; it wasn’t as storied or extensive as the Parisian catacombs, but it had its own charm—not least of which, the state police rarely ventured down here, which made it a convenient way to avoid checkpoints and random harassment.
She was halfway home when the scent of decomposing human flesh stopped her in her tracks. She swore, quietly. It wasn’t the first time; in fact, it happened enough that she’d developed a routine: investigate briefly, mark the location, and call it in anonymously to the Public Health Institute. (She’d tried calling it into the PCR once, and the body had remained for days. Thankfully, it had been winter.) The stench was unusually strong, and that worried her. The undercity was always cool, with relatively poor air circulation, and that level of smell meant either it had been there for some time, or—it was going to be bad.
She shifted to thermal vision and scanned the area. Nothing was moving—not even rats; she probably didn’t have to worry about being jumped, then. The two most obvious causes for a number of bodies lying around were gang violence—likely, someone pissing off the Dvali—or bad drugs. There were always people setting up jackleg drug labs in the undercity, and always people willing to try the results. She hadn’t yet seen the one she feared the most, the reason she personally checked every time she came across something like this—disease. Tuberculosis burned through the Indian subcontinent, AIDS was making a comeback, and she was intimately familiar with the horrors coming out of Russian labs with names like Vector and Biopreparat.
She always carried basic biosafety gear with her—gloves, mask, goggles, it would hold her against anything short of a BL4 hazard (in which case she was screwed anyway)—and it was with the ease of long habit that she geared up. Last but not least was a dab of Vicks under the mask to help counter the smell.
It wasn’t enough.
The wall fell away into a ragged opening that showed recent tool marks, barely wide enough for a single person. She edged through, pulling up short as her boot came down on something that crackled wetly. She shone her flashlight around and recoiled; giant roaches carpeted the ground, rippling in sickening gyres. Where the light touched them, they tried to skitter away, succeeding only in breaking free of one whirl and joining another. She swallowed her gorge, reached down with a gloved hand, and picked one up. Its abdomen was swollen almost to bursting; its right-side legs flailed wildly, while the others barely twitched. She shuddered and let it fall to the ground—what the hell could give a cockroach a stroke?
Every instinct screamed at Sloane for her to turn and run. She clenched her jaw and let her training take over and shoved the screaming in her head down where it wouldn’t interfere. She’d been right; it had been bodies, plural. Ten—maybe twelve—of them, all crammed in the pathetic little squat that they’d tried to make into some semblance of a home. The clinical part of her mind took notes: no signs of violence, no bullet holes in the ancient brick. It looked like they’d all died in their beds. They were well-advanced into decomposition, bloated and distorted, foam encrusted around blackened lips, so much so that one body blended into another. From her vantage at the entrance, she couldn’t make a reliable count—they all seemed to blur into one giant mass of ruined humanity.
The stink was concentrated here, penetrating the pores of the rough-worked stone walls and floor. It was voided bowels and putrefying flesh overlaid by the pungent, oily musk of the roaches, with finishing notes of ammonia and something that smelled not like the usual heavy, sweetish rotting-pork-and-soured-milk smell she was used to, but sharper, hotter, almost burnt. It wasn’t the scent she expected, and a warning jangled up her spine. She needed a closer look.
Sloane made her cautious way to the nearest body, clearing the roaches away with the light where she could and the edge of her boot when she couldn’t, and she saw what had attracted them. Blood. It had soaked the tattered blankets and flattened cardboard, and she could see where the roaches had torn holes in their rush to devour. It had spread thinly and dried in a rusty stain on the stone—dried, but not coagulated.
She squatted to look at the body, as close as she could without stepping in the dried blood. Up close, she could see movement around the eyes, the flash of aged ivory that told her the flies had been here. Even the maggots looked sluggish. She used the blunt end of a surgical probe to gently push back the swollen eyelid and investigate the writhing mass—a sizeable number of them were dead, and the sclera of the eye underneath was a dark, malevolent red. The skin—the skin was unnaturally smooth, and in the dim light, looked almost black. As delicately as she could, she pressed her fingers against its face. The skin crackled and split, sliding greasily along the cheekbone, and sliming her glove with uncongealed blood.
Sloane knew what it was, though she’d never seen a patient that presented with these symptoms—hardly surprising, considering the disease had been dead in the wild for longer than she’d been alive. This was the nightmare. “Fucking shit,” Her voice echoed over the rustling of the roaches, in the metropolitan French that still slipped out when mere English wasn’t enough to express her feelings. “Espèce de malade, you brought it back, you fucking idiots brought it back!”
Smallpox. And not any smallpox, but the hemorrhagic variant that was almost invariably fatal.
Sloane moved quickly but methodically. Poxviruses in general were only ranked BSL-2; they were large viruses, primarily transmitted through inhalation. Her boots and clothes would be a complete loss, but masks, gloves, and goggles were otherwise sufficient protection. That didn’t mean she was going to extend her exposure; whatever samples she wanted, she needed to take now. She wasn’t coming back in here once she was gone. Tissue and blood samples, exemplars of the roaches and maggots, samples of drug ampoules and even a couple Neuropozyne vials, one half-empty, and one that looked untouched. If she was very lucky, one of the things she brought out would point a finger at where the disease had come from.
She edged her way back out of the narrow crack in the wall and stripped down to her underwear, tossing the contaminated clothes back through the hole. She shivered as the cool air hit her skin. Her bare feet crunched on the ground, and she wasted no time in heading back to the abandoned LIMB clinic. It had the means for her to decontaminate herself, and if she could get its backup generator up and running, she might be able to do some simple tests in their lab.
While she backtracked, she put a call through her Infolink. “What do you want?” Kazatel didn’t waste time on niceties.
Sloane didn’t, either. “I need three—no, four—standard smoke grenades, four mine templates, and a kilogram of formaldehyde crystals.” She knew Kazatel wouldn’t be the one actually making the trade, but he had contacts everywhere, and didn’t mind playing the middleman if there was a profit to be made.
“Three vials of Neuropozyne.” Kazatel didn’t hesitate.
“Highway robbery,” she retorted. “Fine. Leave the goods in the safe in the old visitor center, the usual code. I’ll leave the Neuropozyne there when I make the pickup.”
“Twenty-four hours,” he said, and cut the connection.
If Kaz came through, that would take care of decontaminating the site. (She wasn’t about to leave this one to the Public Health Institute.) It was a trick she’d picked up years ago—a smoke mine with about three-quarters of its filler replaced with formaldehyde was hands-down the most efficient, controllable decontamination method she’d ever come across. Four mines might be a little overkill for that small an area, but better safe than sorry.
Several hours later, Sloane was ensconced back in the abandoned clinic, thoroughly decontaminated, and was hard at work. She missed her Army gear, especially the hand-held sequencer designed specifically to identify biowarfare agents. If she still had it, she’d be done already. Instead, she had to make do with what she had. The lab had been designed for surgical support and biopsies, but it did have two useful pieces of equipment: a basic gene-sequencer and an electron microscope. The second had allowed her to confirm her diagnosis; variola was a very distinctive virus, and the blood and tissue samples were swarming with it. Now, using the known infected sample as a control, she just had to run all the samples through the gene-sequencer. With that and some basic data crunching, she could determine whether the dead had all been infected with the same strain, and maybe get a hint of what the infection vector had been. It wouldn’t be a smoking gun—although the drug ampoules were all single-use, cross-contamination was always a possibility—but any direction was better than none, and the more information she could hand off to—whoever—the better.
Finally, she reached the last sample, the intact vial of Neuropozyne. She pulled it out of the baggie and frowned; she hadn’t noticed in the dim light of the catacombs, but in the brighter illumination of the lab, it was clear that it had been tampered with. The bright orange rubber flange along the top was gone, replaced by a darker orange substance that looked like sealing wax. She turned it around in a gloved hand, looking for some other clue—and it was there, a simple design impressed into the wax. A single drop of liquid overlain by a trio of dashed lines, identified with Greek letters.
Sloane’s hand began to shake, and with a distant part of her mind, she admired the engineering that had gone into the reaction, while the rest of her mind tried to reject what she was seeing. The last time she’d seen that emblem had been almost two years ago…
CHECHNYA, SEPTEMBER 2027
She fades in and out of consciousness. Her chute’s caught in a mass of branches, and she’s tangled in the shrouds. Someone’s singing ‘Blood on the Risers’ in a ravaged voice, and she realizes it’s her. Merde, she hurts. Her right leg’s shattered, her left arm’s so badly tangled that she can’t feel it at all, and her suit’s auto-tourniquet’s clamped down on her left leg. Her right eye feels like it’s glued shut. Her face feels like it’s on fire; it hurts to move her head, but she has to see what’s wrong with her leg. It takes her several tries before she understands that there’s no leg there for her to see; something tore it off above the knee. Only the tourniquet kept her from bleeding out.
There went my plan to walk out of here. The thought strikes her as inescapably funny. She can’t stop giggling, even as the darkness swallows her up again.
Fingers on her savaged cheek bring her to consciousness with a soundless scream. The blurry form in front of her turns and yells something that sounds garbled and strange for a moment until her brain catches up and parses it as Russian. “<<This one’s still alive!>>”
Time’s funny. She isn’t sure if it’s a second or a moment—it just blips and someone else is standing in front of her. This one, she recognizes. Three inches from one of her targets, and she’s down to one eye and a semi-working arm.
But, hell if she can take him down now, his men will probably kill her quickly. Better than this slow bleeding out.
Lermontov’s saying something—too much work to try and parse it right now. Keep talking, asshole. Focus. Knife, right under her fingertips. Concentrate on easing it out so they don’t notice, they don’t hear, and they don’t, in the first goddamn thing that’s gone right on this mission (don’t jinx it, Doc). The world’s a knife in her hand and Lermontov’s ice-blue eye. Eye’s a chancy target but he’s wearing armor, she has to make it work.
He takes her face in his hand. Turns her good eye to face him. Speaks English, now. “Anything to say for yourself, little she-wolf?”
No way she can resist a straight line like that. Her voice is a husk, a shadow, but it does the job. “Do svidanya, suka.” She brings the knife up with all her remaining strength, the arc of it pure and true, and then he moves back a hair’s breadth and she’s not quite fast enough and the blade bounces off his cheek and gouges a bloody furrow across his nose and forehead.
He takes it away from her before she can put it to her own throat. His men are baying for him to kill her. “<<I have a better use for this one,>>” he announces. Cold steel against her face, toying with her with her own knife. The blade taptaptaps against her face. She can’t stop herself from flinching away from it. Weak. Tries not to despise herself for it, the medic fighting the soldier. “<<Keep her alive, if you can. Leave her at the consulate in Grozny. We’ll send a message to the Americans that they shouldn’t send a little girl to fight a man’s war.>>” She’d kill him for that, if she could. But her strength is puddled on the ground beneath her and all she can do is watch as that cold shining steel rises toward her good eye and it’s pain and fire and this time she gives herself to the darkness…
PRAGUE: MAY 2029
The soft scream of glass stressed to its limit snapped Sloane back to the here and now, though her body throbbed with the echo of remembered pain. Carefully, she disengaged her fingers one at a time so the vial didn’t shatter in her hand.
The Liquidators. She’d assumed that someone took care of them after ODA Thirteen’s failure, but—that hadn’t been long before the Incident, and the Incident had fucked everything up. It seemed that Lermontov had taken advantage of the world chaos to dig in, find a niche, and prosper. And if that were the case, she couldn’t deal with the situation alone. No matter how much she wanted to be the one to bring him down; no matter how much she owed it to her dead.
She needed to call in help. And maybe, just maybe, this was a way for her to get back into the game.
Sloane ran down her sadly-truncated list of contacts. SOCOM was out; scuttlebutt was that they’d had to close down Stuttgart in early ’28—well, what did they expect after the U.S. pulled out of NATO?—and she didn’t have a way to contact them, in any case, given the way they’d retired her while she was still comatose. The few old Army buddies that had survived the Incident either had her blacklisted or had gone merc; either way they were a dead end. She flipped through a couple more names, then scrolled back. It hung there, superimposed on her vision. Stefan Gerber. Stefan had been SOCOM’s liaison from the BND, back in the day. They’d dated once; the chemistry wasn’t there but the friendship was. Last she’d heard, his brother was climbing the ranks in Interpol. That might be fruitful.
She checked the time—9 AM. “Guten Morgen, Stef, it’s Sunny. Yeah, I’m still in Prague. No, it’s not nearly as nice as it used to be. Listen, I came across something that needs to get official notice. You remember a Russian group calling themselves the Liquidators…?”
Notes:
Summary for those who skipped: Sloane finds a number of OSDs containing critical data in pursuit of her private agenda of hunting down those responsible for the Aug Incident. On her way home through the sewers, she comes across some dead bodies, and determines they were killed by weaponized smallpox. She follows up, and discovers that the disease was spread by tainted Neuropozyne. The organization responsible, the Liquidators, are also the ones responsible for the loss of her Special Forces team two years ago, and she has a brief flashback. Sloane follows up with one of her old contacts to make sure that someone’s apprised of the new threat.
Chapter 6: Back at the Clubhouse
Summary:
Adam finds an unexpected ally within TF29, and is assigned to follow up on rumors of a bioweapon used by a new terrorist group. But when his investigation leads back to the Illuminati, he must follow up on the potential threat in his own backyard...
Notes:
Updated December 2021. Two updates this week, because life caught up with me and I'm behind!
Chapter Text
PRAGUE: MAY 2029
“Agent Jensen, good of you to join us.” Adam slung himself into one of the briefing room chairs and tried to parse whether Miller was being sincere or sarcastic. After the Glasshutte, it could go either way. He gave a mental shrug and decided to treat it as the former.
“About bloody time,” MacReady grumbled from his own seat.
If Miller hadn’t been there, Adam would have returned Mac’s snark full-force, but in front of their mutual superior, Adam contented himself with a deliberately mild, “Got here as soon as I heard.” Mac scowled, finding nothing exceptionable about the remark. That had been the point; Miller could usually be relied on to shut down Mac’s overt displays of antipathy toward augs. Adam had observed that the two men usually worked well together, but the shared command structure rubbed both of them the wrong way, and Adam could occasionally use that friction to make things a little easier for himself. Or, at least, to shut MacReady up, a benefit in its own right.
“We’re just waiting on—” the door slid open again. “Ah, Agent Gerber. We were just waiting for you. If you would be so kind?” Miller gestured to the head of the table and took a seat.
“Of course, Director.” As Gerber took his place, Adam took the opportunity to make a covert study of the other agent; to the best of his knowledge, this was the first time their paths had crossed. Hantz Gerber was a slender man in his late 20s, with hair so blond it was almost white and a bone structure that might once have been called “aristocratic”. From what Adam knew, he’d come to TF29 from GSG-9, the German federal version of SWAT. Adam had a deep respect for GSG-9; early in his SWAT career, he’d attended a seminar given by one of the founding members of the group, then in his 80s, who had patiently explained that the ideal mission was one in which the good guys never fired a shot. It was an ethos that Adam had embraced.
From the head of the table, Gerber nodded to each of the seated agents. “Good morning, gentlemen. Agent Jensen, it is good to make your acquaintance again.” As Adam looked at him in surprise, Gerber smiled thinly. “You commanded the Detroit team at the 2023 Combat Team Conference, as I recall.”
Adam remembered it vividly; the CTC was informally known as the “SWAT Olympics”, and the competition to get in was fierce. He shrugged. “We didn’t do so hot.”
Gerber shook his head. “Fourth place was an entirely respectable showing, given that it was your team’s first qualification. Nor, if I recall correctly, did they qualify in ’27, under other leadership. But I digress.” Adam, watching him, thought it had been an entirely deliberate digression, and wondered just what it meant. The unexpected attention made him want to squirm. The man he was now had nothing left in common with the man Gerber clearly remembered—did he? No. He’d been through too much, lost too much. And yet... and yet Gerber’s words touched something deep inside him, a flicker of light illuminating something that maybe wasn’t as ruined as he’d thought.
Adam gave himself a harsh mental shake. A mission briefing was no time for maudlin woolgathering.
“Last week,” Gerber continued, “a high-level analyst at the Bundesnachrichtendienst received intelligence from a confidential informant, codename SEABISCUIT, about a potential biowarfare incident in Prague, originating from outside Czechia’s borders. The BND considers the source to be highly reliable—“
MacReady interrupted, “I know your brother. Stefan doesn’t even trust his socks, and you’re telling me he considers this source ‘reliable’?”
Gerber sighed. “You malign him. Stefan has complete confidence in his socks. They protect him from his shoes, which are much less trustworthy.” MacReady snorted, and Adam found himself suppressing a smile.
Miller just waved a hand. “Continue, please.”
“Of course. The information was passed through un-official channels to Stefan. Stefan spent many years as an intelligence liaison with allied special forces units, hence Agent MacReady’s acquaintance with him. He maintains extensive contacts among current and retired operatives. And, yes, Stefan considers SEABISCUIT highly reliable,” Gerber explained, and Adam wondered briefly about the light emphasis Gerber had placed on the word ‘highly’.
“Well, that narrows it down to, what, maybe a dozen people?” MacReady wasn’t about to let it go, and Adam found himself unexpectedly irritated at the attempt to ferret out the CI’s identity.
“Pretty sure CIs are confidential for a reason,” he offered.
“Look, Jensen,” MacReady growled, “maybe you’ve never been burned by bad intel, but—“
“Enough,” Miller interrupted. “I understand your concern, Mac, but for the moment we’ll accept the BND’s evaluation of the intel’s reliability as good.” He glared around the table. “Now, if you all don’t mind?”
MacReady scowled, but complied. Adam leaned back in his seat, folding his arms across his chest. Adam 2, Mac 0.
Gerber pressed a key, and a picture appeared on the monitor. “Major Sergei Lermontov, late of the Russian GRU, now head of a far-right nationalist group calling themselves the ‘Liquidators’. They started to coalesce in ‘27; the United States Special Operations Command attempted a surgical strike on them late that year, but the mission failed. Lermontov’s anti-augmentation rhetoric—“ the way everyone in the room carefully didn’t look at Adam was as loud as a shout “—no doubt helped it gain membership after the Incident.”
“What happened to the Yanks?” MacReady asked.
Gerber shrugged. “We don’t know. Intelligence-sharing with the Pentagon has become more difficult since the US caused the NATO collapse in ‘26; our request for records was denied. They may not even have them; the mission occurred not long before the Incident, in which USSOCOM suffered significant losses due to their high percentage of augmented operators. We know that the team assigned to the mission was ODA-13, and our intelligence suggests they suffered one hundred percent casualties.”
Miller and Mac made simultaneous noises of dismay, but it was Miller who spoke. “So that’s what happened to the Wild Boys. Damn shame.” To Adam, he added, “U.S. Alpha-team, biowarfare specialists. Some of the best in the world.”
Adam wasn’t sure if it was consideration on Miller’s part, or if he was doing a bad job controlling his irritation at having the conversation go over his head; either way, he gave Miller a brief nod of acknowledgment. “So where exactly do I come into this?” he asked.
Gerber brought up another image. It appeared to be a standard-issue Neuropozyne bottle, but Adam’s familiarity with the real thing let him immediately identify the differences. “That’s been tampered with and re-sealed,” he said.
“Correct,” Gerber said. “SEABISCUIT provided this for analysis. What you are looking at is Neuropozyne that has been contaminated with weaponized smallpox, probably originating from Vector. It has some—peculiarities—that the BND’s biowarfare lab is currently investigating.” Miller took this in with the stony expression of someone who already knew, but MacReady’s scar showed starkly against the sudden paling of his face, and Adam was, for the first time since his augmentation, unreservedly glad of the biofilters on his lungs and his Sentinel.
“Bloody fuck,” MacReady breathed, and for once Adam was in full agreement with his nominal superior.
Gerber looked at Adam. “Forgive me if this is intrusive, Agent Jensen, but if I understand correctly, you are immune to most bioagents?”
Adam swallowed hard, but nodded assent. “Theoretically. I’ve never actually had to put it to the test.”
Gerber nodded. “The answer to your question, Agent, is two-pronged. First, you are the one agent in this office who is unlikely to be compromised in case of an accidental exposure. Second, as an augmented individual yourself, you will be able to discreetly pursue the investigation among the augmented population of Prague without drawing the excess notice that a non-augmented authority figure would.” And damn if Gerber didn’t make it sound like he was a genuine asset, rather than—Adam cut that thought off at the knees.
“And speaking of, Jensen,” Miller rumbled, “there a reason you haven’t picked up your allotment of Neuropozyne from the infirmary?”
Not that you’d believe, Adam thought sourly. “Wanted to finish off what I already had,” he lied. “I’ll take care of it.”
“Today, Agent.” Miller responded. “We know our Neuropozyne is clean.”
Adam nodded. “Yes, sir.” If Koller couldn’t find someone to pass it on to, he could use it to buy information. In some areas, it was a readier currency than credit chips. “Anything else I need to know?”
Gerber offered him a faint smile. “I’ll forward the full data packet to your email, and make certain you’re on the distribution list for further intelligence developed by SEABISCUIT.” Adam noted Gerber’s shift to informality, but what it meant he wasn’t yet sure. Gerber could be just what he seemed, a fellow professional just trying to get the job done, or he could be the Illuminati plant, and the informality just a way to get closer to Adam. (Even as Adam was trying to find the plant. It was enough to make his head spin.)
Adam’s thoughts were interrupted by MacReady’s flippant, “I’d check your garage, if I were you. Never know what could be hiding in there.”
Adam sat firmly on his temper. “Was planning to make that my first stop,” he said, as calmly as he could. “My mechanic’s not going to want tainted Neuropozyne on the streets any more than we do.” It wasn’t the response he’d have liked to make.
“Good,” Miller interjected, one hand rubbing wearily at his forehead. “Keep me updated.” He made a little gesture of dismissal, and Adam managed to be the first one to the door without looking like he was escaping.
As he exited the infirmary, Adam’s enhanced hearing caught the edges of MacReady’s annoyed, “What the bloody hell did you think you were doing in there?” and Gerber’s unruffled reply, “Team building.”
Team building. Gerber was doing all the things Mac should have been to bring the new guy along. All the things Adam had done, when he’d been in Mac’s position a lifetime ago. Adam missed the easy camaraderie of his SWAT days, missed the feeling of being part of a team. But if he was going to find the Illuminati influence here, he couldn’t afford to get too comfortable. Couldn’t afford to be part of the team. Had to be on the outside. No matter the personal cost.
He pulled his coat around him and stalked out, not caring who watched him go.
Adam took the steps down to the Time Machine two at a time. He’d skimmed through the case file on the metro, and had discovered a new appreciation for his Sentinel. He’d never been prone to motion sickness, but the SEABISCUIT intel included pictures, and they were enough to turn even the strongest person’s stomach. He found himself wondering what kind of person would walk into that charnel hell, not knowing what was waiting for them—they certainly didn’t lack for courage. He could admire that.
He passed the intel up to Alex while he was waiting for the elevator; maybe the Collective could fill in some of the missing details. (He ignored, as best he could, the sensation of vomiting through his eyes that he always got with a big data upload. Neuroprosthetics were funny things.) He already knew that the most glaring hole was going to remain empty—the PCR were, as usual, refusing to cooperate, and they didn’t keep detailed statistics about augmented deaths anyway. But there were other areas where the Collective could be useful. He suspected they could access the U.S. military intel the European agencies were having trouble acquiring. And if they couldn’t—he made a mental note to shoot Jarreau a secure email; Adam didn’t doubt that the former SEAL could get some cooperation, if needed.
Adam stepped out of the elevator and paused at the sight of Koller alternating between mopping up something unwholesome-looking and using the mop as an imaginary dance partner, while “Weird Science” blasted from a battered set of speakers. That was something he didn’t see every day, and yet somehow was entirely typical of what he’d come to know of the eccentric young man. (He had to admit, the kid was starting to grow on him.)
“Koller,” Adam tried to get his attention, but the music drowned him out. He tried again, louder. “KOLLER!”
Koller’s head snapped around in mid-dance-step, and Adam caught him before he stumbled into the nearby table. “Shit, Jensen, you scared me!” The music abruptly cut out. “Make some noise when you come in here, would you?”
Adam refrained from pointing out that the music would have drowned out a marching band. “Sure,” he said, somehow managing to keep a straight face. “Before you ask, the augs are fine. I just have a couple questions.”
Questions were a sure way to trigger Koller’s anti-authoritarian streak and divert him from the deployment of puppy-dog eyes and protestations of sadness at not getting to fondle Adam’s augs. “What kind of questions?” Koller asked, suspiciously.
“Nothing that’s going to endanger you or your clients,” Adam reassured him. “Wondered if you’d heard about someone dealing in bad Neuropozyne.”
“Fuck, no!” Koller scowled. “Believe me, Jensen, if I knew about something like that, you’d know, and so would all my clients. I told—I mean, I’m not going to spread rumors about it, I’m not irresponsible, but if I had hard facts, I’d be telling everyone.”
Adam caught Koller’s quick redirection. “You told... who... what?”
Koller shook his head, jaw setting in a mutinous expression. “Can’t say. I promised. Just forget I even started to mention it, man.”
“Koller... ” Adam pressed. His sudden focus on Koller triggered his CASIE, but the readings it started throwing out bordered on the nonsensical. With a mental shrug, he turned it off; either Koller was that weird (which was entirely possible), or he had some way to jam the CASIE; either way, it was useless to him. “If there’s someone else involved—“
“No!” Koller practically shouted, then lowered his voice to a frantic hiss. “Look. People sometimes say things to me, they say, ‘This goes no farther’, and they come back to me because they don’t. It’s patient con-fi-den-ti-al-ity, man,” he drew the word out. “I promised. I’ll tell you whatever else I can, because man, that’s some bad shit, but just... don’t push, okay?”
“All right,” Adam held up his hands in a placating gesture. “What can you tell me, without violating anyone’s confidences?”
Koller nervously ran one of his hands through his hair. “Okay, look, I can tell you what I told the other person. None of my regulars have gotten anything weird that I’ve heard of, and none of them have disappeared more than usual. There haven’t been any big raids lately, so…if more than a few people dropped out of sight, I’d probably notice.” He gave Adam an edgewise look, as if he was worried about saying even that much. “D—they’re really worried about this stuff. Even more than you. ‘Existential threat’, was the phrase they used. Didn’t tell me what the nu-poz was tainted with, just that it was bad, and I needed to keep an eye out for a mark that looks like the old Chernobyl liquidators’ medal.” Adam’s eyebrows went up at the detail; Koller shrugged. “Recent history, man. Little guys like us always have to keep an eye on the eight-hundred-kilo gorilla.”
“Right,” Adam said. He scratched at his beard for a moment—fuck, he missed fingernails!—and finally said, “That other person comes to you again, go ahead and tell them that I’m asking questions.” He hesitated, then added, “Go ahead and give them my Infolink number if they want it. Tell them—“ again he paused, considering his options, “—tell them that we might have a German friend in common.”
Koller exhaled hard, clearly relieved that Adam was being reasonable about the whole thing. “I can do that.” He grimaced, then added, very carefully, just as Adam was turning to leave, “Heyyyy, Jensen… you know the Dvali, right?”
Adam paused. “Not personally, but I know of them. Why?”
“’Cause… I maybe heard that someone’s trying to cut into their nu-poz smuggling business, and they proooooobably aren’t too happy with it. And these freaks you’re after, dealing in contaminated nu-poz, might be connected.” Koller shifted uncomfortably from foot to foot. “You don’t want to get caught between the Dvali and someone they’re after.”
Now that was a valuable piece of information. Adam laid a hand gently on Koller’s shoulder. “I didn’t hear it from you.” With his other hand, he dropped a bottle of Neuropozyne in the pocket of Koller’s labcoat.
Koller raised grateful eyes to Adam’s face. “That’s—that’s great, Jensen. Thanks.” Adam squeezed his shoulder in brief reassurance, then turned to make his way out.
He took the back way out, away from prying eyes; it was the fastest way to get to what he’d mentally dubbed ‘Underground Prague’. He’d take a quick look around, see if anything turned up. He wasn’t by any means an expert on all its nooks, crannies and hideaways, but he’d started to get an idea of where people tended to cluster. People tended not to pay too much attention to him if he looked like he was just passing through, and his hearing was keen enough to pick up most conversations. He didn’t expect to get lucky, not this early in an investigation, but stranger things had happened.
The walls of Překážka cast long shadows in the bloodied light of sunset as Adam turned his steps toward his apartment. People were definitely spooked, he’d picked that up quickly enough. He just didn’t have a good read on what was causing it.
He was buying a fresh pack of smokes from the stall near the fountain when his infolink pinged. “Got some of that information you were looking for,” Alex said, cheerfully. “Ready to get your socks knocked off?”
Adam ducked into the shadow of one of the countless little dead-end alleys. He took a moment to light himself a cigarette, then replied, “Thrill me.”
“First of all, Janus is pretty pleased with you, because these guys weren’t on our radar, and it looks like they should have been.”
“Great,” Adam responded automatically. “He can tell me that in person.” It gnawed at him, working with someone he didn’t know, couldn’t put a name or a face to, especially given how much Janus knew about him.
“Doesn’t work that way, big guy, you know that,” Alex took it in stride, as she always did.
“So you keep telling me,” he sighed, and sucked in a lungful of smoke. “Go on... ”
“We focused specifically on intel from the American side, the lost mission, like you asked, and found some... inconsistencies.”
Adam didn’t bother to tell her he’d just wanted to fill in the missing intel; instead he said, “Figured something that could take down an entire special operations team might need some special handling.”
“Well, good news for you, the Liquidators didn’t take the team down. Not directly, anyway. According to the records, their usual bird was already en route to Afghanistan with their replacements, and the backup was down for maintenance for an ‘unspecified problem’. Which meant the Army had to fall back on one of their private contractors.” Alex’s voice, usually expressive, went flat on the last two words.
“Belltower,” he said.
“Belltower,” she confirmed. “The ops plan was to have the team do a HALO jump from 60,000 feet to avoid air defense radar. Instead, military air traffic control showed the plane descending to 20k, well within Russian missile range. The black box was never recovered, and there were no communications from the flight indicating any problems. Kinda screams sabotage to me.”
“You think the Liquidators are part of the Illuminati?” Adam asked.
“Doubt it,” Alex responded. “What I think is that the team were too good at their jobs, and they got too close to an Illuminati op or two, so they needed to be eliminated. The Liquidators just happened to provide a convenient excuse and some useful pawns. It’s the usual pattern for them. But here’s the thing—it may not have been Belltower that caused the sabotage. Turns out there was a survivor. Kind of a coincidence, don’t you think?”
Adam frowned. “That’s a stretch, Alex. Elite teams like that are all about unit cohesion.” The kind of unit cohesion he’d worked hard to foster in SWAT and SI, and that he was missing in TF29. The kind that he wondered if he’d ever be part of again.
“Yeah, well, remember the neighbor you were gonna check out? The one with ties to Beth DuClare?”
Adam had to think—it had been a couple months, and he’d been busy settling in to TF29, then there had been the whole miserable situation that Picus was calling the “Children’s Crusade”, which they were still getting fallout from… “You mean Delacourt? Downstairs? Haven’t really had time—wait. Her?”
“The very same,” Alex said grimly. “Isn’t it a little fishy that the only person to survive a situation that took out the rest of her team in sketchy circumstances just happens to be the one with Illuminati connections? And that she ended up with cutting-edge Sarif augs of dubious authenticity, installed, by everything we can find, by a fairly high-ranking Illuminata? And, of all the places she could go, she ends up in Prague, a city that hates Augs? I mean, yeah, it could all have an innocent explanation, but the combination is pretty damning.”
Adam’s thoughts had run down the same lines. “I’ll find out,” he growled. “What can you tell me about her now?” His cigarette had burned down almost to the filter; he took one last drag, stubbed it out on the filthy brick, and tossed it in a nearby trashcan. As he headed back to his apartment complex, most of his attention was on Alex.
“Enlisted in the Army at the age of 17, got immediately tagged for Special Forces—that would have been the early teens. Assigned to the 10th SOG—they’re the ones that cover Europe, west Asia, and north Africa…”
“Wait,” Adam interrupted. “Didn’t you tell me she was a medic?”
Alex sounded exasperated. “Yeah, she is. A Special Forces medic. And before you ask, it’s not in her official jacket—this all came up when we dug into ODA-13. Anyway, from what we can tell, she’s spent her career in and around every eastern European and western Asian hotspot in the past decade. Regular tours in Afghanistan means she probably cut her eyeteeth on Pakistani and Russian bioweapons labs. No real details, those parts of her military record are classified so deeply even we weren’t able to get to them this fast—but that’s not unusual. She’s got a bunch of medals, though, and they’re all classified.” Alex paused in the recitation, then said, “Too much to hope that she’s let herself get out of condition? Or is still adjusting to the augs?”
Adam thought back to the few times he remembered paying attention to Delacourt. Mostly, it was an impression of someone tall and lithe, with a surprisingly powerful build and an unnerving tendency to take the most direct route between her and her destination—“She jumps off balconies and free-climbs the walls instead of taking the stairs. I’m gonna say… not a chance.” He regretted not following up on her offer of coffee the day he’d moved in—he could have felt her out, gotten to see some of what made her tick. He had a hard time reconciling the thought of someone who’d run to help a sick child with the kind of person that could cold-bloodedly betray the people she’d fought and bled with. “What happens if she’s just a dupe?” It had happened to Megan, after all. People could be seduced into doing terrible things for the promise of a greater good.
“Turn her if you can,” Alex replied, “We can always use an asset like her. And if you can’t—”
“I don’t do wet work,” Adam harshly reminded her.
“—then let us know and we’ll take care of it,” Alex finished as smoothly as if it had been what she’d been planning to say. (And maybe it had, but Adam wouldn’t have bet on it.) Once again, he was reminded that he and the Collective were partners of convenience, and while their ends might coincide, the means they were willing to accept often didn’t.
“Don’t worry,” he said, projecting confidence to cover his unease. “I’ve got it handled.”
Alex chuckled. “Well, that’s why we pay you the big bucks,” and cut the connection just as Adam reached the courtyard. The dark-robed proselytizers for some augmented cult were just packing up to leave, and lights were coming on in the surrounding apartments. He glanced up—for the moment, he was considering Delacourt’s apartment to be enemy territory—to find its windows were still dark. Depending on how long she’d be out, this could be an unlooked-for opportunity to do a discreet toss of her apartment, see what he could uncover.
Some providence was smiling on him, because his second most-reliable source of gossip was on the stairs, chatting with people as they went by. Teresa ran the bar down by the metro, and had a kind word for just about everybody—even him. Thinking quickly, he pulled his left arm from his coat sleeve and tucked it across his chest, then pulled his coat back around him. In the twilight, it should look like it was in a sling. That done, he headed toward the stairs, more slowly than usual.
Teresa noticed. “Hey,” she called, in the sharp soprano he always found a little surprising coming from her. “Are you okay? Do you need help?”
“Had a bit of an accident,” he did his best to sound a little embarrassed. “Mechanic says the problem’s not the aug. The doc around? Figured I’d see what she said.”
Teresa’s eyes softened with compassion. “I think she said something about a delivery, and she’d probably be out late. Hmm. Funny,” she mused, “none of the pregnant women I know should be that close, but,” she grimaced, “things happen. I can give you her number if you need it?”
Adam shook his head with a forced little laugh. “It’s not that bad. I’ll see what it’s like in the morning and follow up with her if I need to. Thanks, though.” He gave her a polite nod, then took the stairs up to his apartment, remembering to maintain his ‘injured’ pace the entire way.
In a few hours, once everyone had gone to bed, he’d make his move. One way or another, he’d get some answers.
Chapter 7: Not the Kind to Lay Down and Die
Summary:
Sloane comes home after a bad night to find an unexpected visitor. Things don't go as either of them expect.
(aka, Let's You And Him Fight!)
Notes:
New year, new chapter, new content!
Chapter Text
PRAGUE: MAY 2029
Sloane limped into the courtyard, pissed-off and aching. Getting jumped on her way home by a bunch of nat-purist kids might have been bad luck, but the pocket secretary their leader was carrying, with her name and photo attached to not nearly enough credits to go after her, argued otherwise. This was a hit—a sloppy one. Anyone who knew what she was capable of would just hire a sniper to take her out from half a mile away; not even she would see it coming.
She leaned on the stairwell wall and tried to pull her scattered thoughts into some sort of order. Tomorrow, she’d follow up on the lead; maybe one of her contacts knew a good computer analyst. She could even contact Sarif—she still couldn’t think of him as ‘Father’—and get the name of that security guy he’d recommended. Until then, her priority was to get home, take some painkillers, get something edible into her, and let her Sentinel get to work on the cracked ribs and broken nose that her HUD kept ‘helpfully’ reminding her about.
She made it to the second-floor landing before she realized that her smart home hadn't responded to the wake-up signal. When a second try returned the factory zero response, Sloane knew it wasn’t an accident. She didn’t believe in coincidence. A quick radar sweep confirmed her suspicions: someone had disabled her smart home system and was still inside, she could only assume to finish the job the bangers had started. She revised her estimate of her enemy’s competence up a notch.
Rapidly, Sloane assessed her options. She could run: abandon her home, find someplace to hole up, or even leave Prague altogether. But on the run, she’d be easy prey, and no matter what her unknown enemy might think, Sloane had never been prey. She bared her teeth in the darkness; even a wounded predator had fangs. That left option two: she could spring the trap, turn the ambush on the ambushers. That was more her style. De l’audace, encore l’audace, et toujours l’audace.
She wasted no time, slapping in the emergency biocell that she kept in the hidden compartment in her right arm. All that time spent getting to know her systems paid off; she dug into the recesses of her operating system for the system overrides, dialed down her pain receptors as far as they'd go and triggered a burst of adrenaline and endorphins that left her feeling almost normal. Worry about the crash later.
Radar picked up one ping inside—Sloppy. Should have been in place already—and her spirit rose; even hurt, Sloane was confident in her ability to handle one person. She ghosted up to her door. A quick scan with enhanced vision was enough to let her see the single target she’d expected. His gold-washed outline seemed intent on her computer, facing partially away from the door. She wouldn’t get a better opening; she was moving before she finished the thought.
Fuck subtle. She flung open the door and threw herself at the intruder in a smooth seamless move. He barely had time to jerk his head up in startlement as she slammed into him in a textbook tackle; the impact drove him into the clinic door with a thud, and she spared a half-second to be thankful she’d reinforced it.
Her satisfaction was short-lived. The impact she’d expected to stun him didn’t, and before she could recover her balance, he returned the favor: augmented hands latched onto her forearms, he pivoted, and hammered her into the wall. Plaster dust drifted into the air, frosting his dark hair and beard, and Sloane felt a cold knot in her belly as she realized how badly she’d misjudged the situation. She'd expected another banger, an amateur, not tall, dark and milspec who lived upstairs—for fuck’s sake, she’d invited him over for coffee—! Hurt as she was, with his augs and expertise, he could probably take her. And it was two punches too late to back down.
Sloane snapped her head out of the way of a knockout blow; Jensen's fist missed her by less than an inch and hit the wall hard enough to crack the brick under the plaster. A sharp jab into his ribs didn't faze him; the faint give of ballistic gel under her knuckles told her she’d need to hit him harder. He feinted a head-butt; her dodge gave him an opening to return her body-blow with interest, and she felt her cracked ribs give way even through the pain overrides. Shit! She needed to put some distance between them; another hit to the ribs and she’d be down.
When he flung her through the kitchen, she let it happen—took the impact on her good side, and rolled behind the dubious cover of the couch. In a desperation move, she sent it flying at Jensen with a vicious kick, hoping to tie him up long enough to bull past him toward the windows. The hope died stillborn when he—who the fuck had swords in his arms?—slashed it out of the air with a blow as graceful as it was powerful. She couldn’t help but admire it, the same way someone might admire the tiger that was about to eat them.
She rolled to her feet, ignoring the flare of pain from her ribs, and he was on her, relentless as a tidal wave. She faltered against the onslaught, clumsily blocked one punch, twisted to take another on the armored shell of her shoulder. A kick to his knee reverberated through her body with a flat crack, but didn't noticeably slow him down. Her breath stabbed in her lungs. She couldn’t find her balance; she was used to the rhythms of a knife-fight, dodging in and out and using her speed to its best advantage. Now, she was weaponless and on bad ground, and worst of all—she barely avoided another of those wicked body-blows, managed to force him back a step with an elbow-smash to the jaw—her speed advantage just didn’t exist.
Rational thought faded. The world was tinted in blood; Sloane’s system monitors screamed warnings—bioenergy depleted, blood loss approaching critical, broken ribs—and she didn’t care. She was beyond exhaustion, beyond despair, beyond even pain; the only thing that mattered was the need to keep swinging. He was so goddamn fast—only her own reflex enhancers let her come close to keeping up, and she was running out of juice… and out of time.
The end was sudden. Her foot came down on something—it rolled, she overcorrected, and Jensen grabbed her outstretched arm and twisted, pulling her into a brutally efficient sleeper-hold. (Again, that ghost of unwilling admiration; she’d had instructors that couldn’t have done it any better.)
“Will you just stop?” he hissed in her ear. Sloane choked out a laugh. Stop. She’d stop when she was dead.
“Fucking finish it,” she coughed. His grip loosened, almost imperceptibly, and Sloane snarled, “Just kill me and get it over with, asshole!”
The next thing Sloane knew, she was on her hands and knees; he’d let her go so fast that he’d practically thrown her to the floor. “You think I’m here to kill you?” There was a note in Jensen’s voice that she couldn’t quite place—incredulity? Horror? She must have mis-heard it. She lurched to her feet—she’d left her last legs halfway across the room, now she was running on sheer stubborn—and turned to face him. He made a dismayed little noise at the sight of her. “Jesus fuck.” She was pleased to see he hadn’t gotten off completely unscathed—a cut on his brow was rapidly healing, and one of his elbows hovered protectively above his ribs.
For the second time that night, she dug deep into her system overrides, this time draining part of her internal reserve. It’d last her for a bit if she didn’t get into a fight again. If she did—well, she’d blow up that bridge when she got to it. The red haze retreated to the edges of her vision, and most of the infernal alarms shut off. She leaned on the kitchen island for support, trying to be unobtrusive about it. “Why the fuck else would you be here?”
Jensen took a step toward her, slowly and carefully, as if she were some wild creature he was trying not to alarm. “Who did this to you?” he asked, completely ignoring her question.
She watched him warily. “Back the fuck off,” she snarled. “None of your fucking business.”
His lips set in a razor-thin, humorless smile. “Might be surprised about what’s my business.” He paused a moment. “And you need a hospital.”
Sloane laughed harshly. “In Praha? Yeah, right.” She couldn’t believe his naiveté. His eyebrows tilted down in what looked like confusion, so she elaborated. “Hospital might treat you if you have a tiny neural aug. Not someone like me. I’ll heal.” Though there was one thing she had to do before the Sentinel really kicked in… She reached up, probed gingerly at her broken nose, and before she could talk herself out of it, snapped it back into place.
When her vision cleared from the resulting white-out of pain, Jensen was watching her with a tight-coiled intensity that made her deeply uncomfortable. Was he was visually dissecting her, or expecting her to collapse? Either way, it pissed her off. “Enjoying the floor show?” she flared. Pain made her voice sharp.
“Not really.” Jensen watched her for a moment longer. "If I wanted a show, I'd have gone to the Red-Light District. I came here for answers."
“Tell me, how’s that working out for you?” she snapped. “Better yet, explain to me why I’m not calling the police. ‘Cause inviting you over for coffee didn’t include recreational B&E.” It was a bluff she had no intention of following up on; best case scenario, they’d both just be dragged off to Útulek. She just wanted to see Jensen’s reaction, prod him onto the defensive. Verbally, since beating the shit out of him was clearly off the table.
One of his eyebrows went up. “Then I call my boss at Interpol and we have a jurisdictional smackdown right here in your living room. And if that happens, whoever else wins, I can guarantee you’re gonna lose. I don’t think you want that outcome.” He sounded oddly sincere about that last.
“Interpol, my ass!” she retorted. “If you were Interpol you could have knocked on that door any time, shown me a badge, and asked for an interview.” She was pretty sure he was glaring at her beneath the eyeshades, and she met him glare for glare. “Unless it’s off the books...” He flinched, almost imperceptibly. “In which case, maybe I should take my chances.”
Jensen crossed his arms across his chest. “Look. What you need to know right now is that I'm not here to hurt you,” he said with some exasperation. “We can discuss the rest when you're not about to fall down.” It was a sensible suggestion; so much so that Sloane was about to agree until warnings lit up along the left side of her HUD. Her hastily-triggered dose of counter-pheromones was like an ice-water bath.
“Then there’s nothing to discuss,” she said flatly, and took a dark amusement in his well-hidden surprise at her refusal to play along. “Except that if you try that CASIE shit on me again, I’ll rip it out of your head and shove it so far up your ass you’ll be tasting it for dessert.” Something twanged deep in her chest, and she coughed. The blood that spattered her arm in a fine spray suggested that she’d nicked the lung. Really, it was a miracle of technology that she was still standing. (She’d have to remember to thank Sarif, eventually. But not too soon; the man didn’t need his ego puffed up any more than it was.) It took her a moment to remember that she’d turned down her pain sensitivity, and no time at all, despite the disapproval of her inner medic, to decide not to dial it back up just yet. The Sentinel was keeping her functional. The rest could wait.
Jensen shifted and swore, quietly enough that unenhanced ears wouldn’t catch it. “Are you always this impossible?”
Sloane couldn’t help the fuck-it smirk that curved her lips. “Nope. Sometimes I’m downright obstinate.” She straightened cautiously, relieved to find that her legs would (mostly) support her unassisted. “So what exactly were you hoping to find by breaking into my home and hacking my computer? My case notes are all encrypted, and the only thing in my email is a note from the Time Machine letting me know I have some books in, and a couple of 419s and a merc recruitment pitch that got past my spam filters.” Fortunately, her research into the Incident was well-hidden in a niche that even her enhanced vision couldn’t penetrate, and he wasn’t asking the kind of questions that would indicate that he’d uncovered it. She couldn’t resist pushing a little harder. “Obviously you didn’t get what you were looking for, or you wouldn’t be sticking around to put up with my charming personality.”
One of his sleek black hands clenched; he turned half-away, and then his attention fell on something among the scattered debris. Before she could react, he took two steps and scooped it up—she’d almost forgotten the pocket secretary from earlier. He studied it for a moment, then glanced back up at her. “Twenty thousand credits. Someone’s a fan of your charming personality.” Now it was his turn to smirk at her scowl, as he tossed the p-sec back to her with a careless ease. “Guess that’s why you thought I was here to kill you.”
Irritated, Sloane slammed it down on the counter hard enough to crack the screen. “Aren’t you a regular Poirot?” she growled. “Fucking amateur hour. My right fucking arm is worth more than that on the black market.”
“And you would know that… how?” Jensen’s voice went cold. He rounded on her, fast and silent and more than a little intimidating, and even she might have stepped carefully if she hadn’t been so pissed. “You wouldn’t happen to be the recipient of black market augs yourself, would you?”
She stared at him in disbelief. “Are you fucking crazy?” The words spilled out of her, too late for her to stop them. It didn’t make sense—what was so important about her augs? She didn’t need a CASIE to realize that was the true reason he was here, not when he was locked onto her like a heat-seeking missile, every nerve and sinew and myomer taut and ready for action. He’d been telling the truth when he said he didn’t want to hurt her, which meant that he probably wasn’t looking for an immediate source of spare parts, but she had no idea what else he could be after.
One more step forward and he was a scant arms’ length from her. She could feel his glare even through the mirrorshades. “There’s only two ways you could have gotten them, and neither of them is through Sarif Industries.”
“Then your intel is crocked,” she said, hotly, “because I guarantee you they’re legitimate.” The air between them crackled with tension, neither one giving an inch. She eased herself into a defensive stance, twisting to give her bad side a little protection, but it would only take one good punch to take her out. They both knew it, but that didn’t mean she had to make it easy.
“Really,” he said, and the lack of expression in his voice only accentuated his angry disbelief. “So tell me how a career enlisted in the Army could afford cutting-edge Sarif augs.”
She balked at that. Sarif may have been the source of fifty percent of her genetics and all of her augmentations, the reason she was alive and whole twice over, but she still wasn’t sure she wanted to claim him as anything, much less her father. Saying it out loud, to a stranger, no less, would make it real in a way that she hadn’t yet wanted to face. “Maybe,” she said, dry-mouthed, “I have a wealthy relative with an interest in my continued welfare.” She tossed it out, a bone to a particularly determined pit bull, and hoped it was enough to satisfy him.
“Bullshit,” Jensen said, almost gently. “I’ve read your file, Ms. Delacourt.” The unnecessary emphasis he placed on the civilian title stung, but she refused to give him the satisfaction of showing it. “You don’t have any living next-of-kin. Millions of dollars in augments with no paper trail, and you expect me to believe that someone gave them to you out of the kindness of their heart?”
“Why should I give a shit what you believe?” she demanded, her anger rising at his stubborn persistence. “It’s the truth. And if your fucking CASIE tries to tell you anything else, go have your head checked.”
“And how,” he hissed, “did your ‘wealthy relative’ get their hands on augs like these?”
Fucking hell, he just would not let it go. “Probably because he fucking designed and built them!” she spat. “David Sarif is my fucking father, okay?” Humiliation burned like fire in her throat, choking her next words off. I didn’t ask for him to intervene, but don’t expect me to be sorry that I’m alive!
“The hell he is,” Jensen snarled back. His eyebrows disappeared behind his shades in a scowl. “I was his goddamn security chief for two years. If Sarif had a kid, I’d have known about it.”
Sloane couldn’t help it; she felt her eyes go wide with astonishment. “You—?” This was the man that Sarif had suggested she look up? Then the rest of his sentence hit her. “What do you mean, ‘you’d have known’? If you were his security chief, you’d have been running the goddamn surveillance on me! Unless you’re going to tell me that Sarif is stupid enough to have left his own people in the dark about a massive fucking security risk!”
For some reason, that seemed to take the wind out of Jensen’s sails; his face twitched in what she thought was a pained look. “Something like that. For his daughter, you don’t seem to know him very well.” He graced her with another frown, but this one seemed less hostile and more… bemused.
“I found out,” she gritted through clenched teeth, “a year ago. On a genetic test. You want the fucking geneprint?”
“Won’t be necessary,” he said, and one eyebrow tilted wryly. “Unless you still want me to get my CASIE checked.”
“Oh, thank you for finally considering that I might be telling the truth,” she snapped. “Why the fuck are you so obsessed with my augs anyway?”
The mirrorshades stared at her for a long moment before he said, flatly, “You’ve got Sarif S7 combat arms, and I have to assume that your other augs are also Sarif military tech.” He took a deep breath. “The S7s were one of a kind, made for one person. Me. They never went into mass production. Which meant that your S7s had to be knockoffs or stolen prototypes.” She could tell by the set of his shoulders that he was watching her intently. “Early this year, I helped shut down an operation that was smuggling the last of Sarif’s tech to terrorist organizations in Europe.” He paused. “Combined with certain other pieces of intelligence… the pieces all lined up.”
Sloane had a terrible suspicion she knew what ‘other’ piece of intelligence Jensen was referring to. “Because there’s no way I could have legitimately survived the loss of my team, is that right?” She shoved herself upright, advancing on Jensen like a wounded wolf unwilling to show its throat in surrender. “That’s it, isn’t it? That’s your ‘intelligence’. You think I sold my people out. Bastard!” Her voice rose to a roar; crimson hazed her vision, and she wasn’t sure if it was pure rage or the protest of systems pushed beyond their operating parameters as her fist lashed out in a ferocious punch.
Jensen caught it. Servo whined against servo, and then, with an effort, he threw her back—a little too hard, but her attack had taken him by surprise. She bounced off the island, staggered, and synthetic fingers caught her by equally synthetic shoulders before she could fling herself at him again. “Will you listen to me?” he growled. “The intel suggested it was a possibility. I didn’t think it was likely, but I had to check it out. And if you weren’t half-dead on your feet, you’d understand that.” He let her go, as abruptly as he'd grabbed her. “Fucking hell.”
Intellectually, she knew he was right, but logic was useless when it was her honor in question. “This is so fucking fucked,” she growled, and her breath hissed out fiercely enough to trigger a flare of protest from her abused ribs. The damnable thing was, she could see the chain of logic that had led him to the assumption. If this, then that. It made perfect sense, if you lacked that one piece of crucial information that realigned all the others. “I have spent my entire adult life fighting terrorists,” she said, forcing it through a throat gone tight with rage. The servomotors in her hands whined as they clenched into fists. (The knuckles on a flesh hand would have gone taut and white by now, and her fingernails would be cutting little crescent-moon divots into her palms. If they clenched any further, would her mechanical fists simply explode in a spray of hydraulic fluid and gears?) She opened her eyes and looked at his expressionless lenses. “Two years ago, I lost both eyes and all my limbs, my career and the closest thing I had to a family, to fucking terrorists,” she kept her voice level through sheer force of will, “and I’m still fighting them. And if you or whoever gave you that intel wants to think otherwise, then I will personally escort you straight to hell.” Despite her best efforts, her final words came out in a feral snarl.
They stared at each other for a long, silent moment. To her surprise, it was Jensen who finally broke it with a heavy sigh. “This is one hell of a mess.”
Sloane sagged back against the kitchen island. “No fucking shit.” The adrenaline drained out of her, leaving her chilled and hollow, and she couldn’t suppress an exhausted shiver. “We’re done here.”
He gave her face a careful scrutiny, and his hand hovered in the air for a moment before falling back to his side. “Still haven’t told me who did all that.”
“And it still isn’t any of your business.” she said, tiredly. She jerked her chin in the general direction of the foyer. “There’s the door.”
“Not yet,” Jensen said, uncompromisingly. “Assume for a moment that I have an idea of what you’re capable of. Someone that can do that—” he pointed at her face “—to you is someone Interpol needs to keep an eye on.”
Sloane could be equally uncompromising. “So go find them. Here’s a hint: they’re not here.”
He threw his hands up into the air in a gesture born of pure frustration. “Oh, for Christ’s sake, I’m not the enemy here!”
“Really?” Sloane didn’t bother to hide the disbelief, or the sarcasm that followed. “You only broke into my home, hacked my computer, hammered the crap out of me, and slandered my name in the course of a goddamn interrogation. I don’t know how you define ‘enemy’, but you’re sure as hell not my friend!”
Jensen’s fist clenched again, and then he let out a gusty sigh. “I pulled my punches,” he said, almost apologetically.
The last bright sparks of anger guttered out; numbly, Sloane sagged back against the counter. She was running on fumes; it was mostly just stubborn pride that kept her from falling on her face at this point. “Yeah,” she conceded. “I’ll give you that.”
“Look,” he said, “I know you’re hurt. I know you’re still standing on pure guts. I respect that.” It would have been condescending if his tone hadn’t been so damn sincere. “But whoever it was did that to you, it’s aggravated assault. Depending on intent, attempted murder. That’s not something I can just let slide.”
“Good luck with that,” she muttered. “It was a pack of rich kids. I got the impression I wasn’t the first augmented person they’d jumped, but the bounty on my head was a nice bonus. In this town, you’re not even going to get an arraignment.”
He gave her a skeptical look. “And they did all that to you.” His gesture took in everything from the broken nose to the now-healing ribs.
“Rich kids, remember?” Sloane said. “One of them shows up in the morgue, they finger me, and I’m the next poster child for another round of police suppression. Or just another dead clank. As it is, they aren’t going to admit that eight of them couldn’t take down one woman.” At his scowl, she added, “Do the math. I’m a soldier. I’m trained to kill.” She paused, significantly, then said, “I pulled my punches.”
Jensen’s eyebrows furrowed thoughtfully. “And that let them get their licks in.”
She shrugged. “More or less.”
He made a noncommittal noise at her blunt response. “Any ideas who might have been behind it?”
She shook her head wearily. The pain was seeping in around the edges as her systems reset. “The kind of people that might be coming after me wouldn’t pull this amateur shit.” She thought about it. “Standard procedure for retired operators is that the personnel jacket is supposed to be buried, just in case someone we pissed off on duty decides to come hunting.” She gritted her teeth against the heartache, and added, “Most of whom probably think I’m dead. SOCOM did their best to bury me with the rest of my team.”
“Seems odd that they’d do that,” Jensen said.
Sloane shrugged again and tried to keep the bitterness out of her voice. “I wasn’t expected to survive, and when I did, they bounced me out on a medical after the Incident. Guess they didn’t want to take the risk that I’d go bugnuts like everyone else. Or pay for the Neuropozyne.” She glared at the floor. “Not that it probably wouldn’t have happened anyway. Losing an entire Alpha team can be covered up. Sole survivors raise embarrassing questions.”
It was hard to tell behind the shades, but she thought Jensen winced. “I… can relate to that.” One hand drifted up and scratched lightly at the twin scars carved into his otherwise-neat beard. “I need to talk to you. Tomorrow. When you’ve recuperated.”
“My enthusiasm knows no bounds,” Sloane growled. “Fine. Nineteen hundred hours.” She glared at him with as much heat as she could manage. “And I reserve the right to kick your ass out if I don’t like the questions.”
“Fair enough,” he said, and headed for the door. He paused, hand on the doorframe, and looked back at her. “For what it’s worth… you’re right. My intel wasn’t complete.” He didn’t wait for her response, just gave a stiff little nod and let the door fall closed behind him.
Sloane stared at the closed door for a moment, bemused, then gathered herself up and made her exhausted way to the bedroom. She would deal with the mess tomorrow.
Chapter 8: The Widening Gyre
Summary:
Adam gets some answers, though not quite how he'd expected to, and ends up with a partner that he never asked for.
Notes:
I apologize, things were looking up this time last year and then I got hit with some more health issues; just when those cleared up, my job changed and took all my spoons. I'm back in the writing saddle again, I hope, and I am working on the next chapters of this.
Chapter Text
PRAGUE: MAY 2029
Adam awoke to the soft beeping of his smart home. He dragged an arm across his eyes to block out the sunlight—he’d forgotten to close the blinds last night—but couldn’t block out the artificial voice. “Good morning, Adam. It is 5:23 am.” Five in the morning and the sun was already up; he’d thought mornings started early in Detroit. The AI continued, inexorably. “Hantz Gerber has replied to your email sent 1:22 am. It reads, ‘P. Station. 6 am.”
Adam pushed himself upright. “Great.” He’d told Gerber they needed to talk, but he’d hoped for a little more notice. Fortunately, he’d showered before finally falling into a restless sleep, but he was still going to have to hurry to make it through all the checkpoints in time to make it to Palisade Station. The guards manning the checkpoints there were particularly aggressive.
Forty minutes later, he exited the station; he’d even had time to smoke a cigarette. Gerber gave him a precise nod as he approached. “Punctual. I appreciate that, Agent Jensen.”
Adam fell into step with Gerber, shortening his stride to match the other agent’s. “Not gonna be rude to someone who’s doing me a solid.” He hesitated, then added, “Though I did get lucky with the checkpoints.”
Gerber cast him a sidelong glance. “So you are not routinely late just to annoy Agent MacReady.”
Adam snorted, “It’s mostly the checkpoints. Annoying MacReady is just an entertaining side effect.”
Gerber made a noncommittal little noise and angled his steps toward a small courtyard that held a coffee kiosk and a few bistro tables. It was still early enough that most of the tables were empty. He gestured to an isolated table. “If you will give me a moment?”
Adam took the chair closest to him; he didn’t care that it left his back to the street. The important thing was that they could have a discreet conversation. Gerber’s quiet friendliness continued to throw him off-balance. He could deal with the unease most people showed around him; it wasn’t comfortable, but it helped him keep his distance. He didn’t want to become friends with someone he might have to betray, and yet… some small part of him couldn’t help but hope that Gerber wasn’t the Illuminati mole.
Gerber joined him, a coffee in each hand. He slid one over to Adam. “Cream, four sugars.” One of Adam’s eyebrows lifted in surprise that Gerber knew his coffee preference. He murmured thanks and took a sip as Gerber continued, “So. What have you come across that requires a private discussion?”
Adam decided to meet Gerber’s bluntness with his own. “Did you know there was a survivor of ODA-13’s final mission?”
Gerber leaned back in his chair. “Your connections are quite efficient, Agent Jensen. Yes, I am aware.”
Adam was taken aback at Gerber’s easy admission. “Why the hell didn’t you say anything at the briefing yesterday?”
Gerber tilted his head, thoughtfully. “That is not the question you should be asking.” He raised a hand at Adam’s scowl and added, “Perhaps you should ask instead, ‘why didn’t they know’?” Adam’s mouth snapped shut on his intended retort as the import of Gerber’s question sank in, and Gerber nodded. “The special operations community is very self-contained, especially at the higher ranks. They know each other, by reputation if nothing else—and the survivor has a formidable reputation. No matter how official communications are impaired, the grapevine is unstoppable.”
The same thing had been true when he was in SWAT. Adam frowned. “So either they’re completely off the grid, or someone’s suppressing information about them.”
Gerber nodded. “Yes.”
Adam’s fingers tapped metallically on the table as the pieces assembled themselves in his head. “It’s not the first; the information’s out there. I found it. You already knew.” Tap, tap, tap. “Someone’s deliberately suppressing information meant for TF29.”
Gerber nodded again. “Yes. And to some extent, that is expected; outside agencies don’t wish to share information, higher-ups only share what they think we need, and so we cultivate outside connections to uncover the information we truly do need. But this seems an oddly specific piece of information to redact.” He sipped at his coffee, seemingly content to let Adam assemble the pieces on his own.
It was a few moments and half a cup of coffee before Adam spoke again. “Miller’s complained that the division doesn’t have a good biowarfare specialist. If someone like the survivor were to come to his attention, he’d want to recruit them.”
This time, the tilt of Gerber’s head was approving. “Especially if the survivor’s CV had been forwarded to the head office in Lyon by one of their contacts. If it were still in the database, it would certainly show up in the Director’s recruitment filters.”
“Unless—” Adam said softly.
“—someone removed it.” Gerber finished.
Adam leaned back in his chair. “You think TF29’s been infiltrated.”
Gerber’s sharp bark of laughter was without humor. “No, Jensen, I know the task force has been infiltrated. It was inevitable; it was formed too quickly, too haphazardly, under chaotic conditions. The question is not ‘if’, it is ‘who’, and ‘why’. If it is simply a matter of one intelligence agency keeping tabs on an upstart, well, that’s tolerable. All part of the game. But… consider. The intelligence we receive dictates everything from the nature of our targets, to the intensity of our investigations, to the lethality of our response. We’re supposed to be bringing some order back to the world. If we have the wrong targets, or the wrong reasons, or the wrong reaction, then we’re only compounding the chaos.”
Adam couldn’t believe what he was hearing. “So why are you telling me this? I could be one of the moles you’re talking about.” I am a goddamn mole. But, dammit, I think we’re on the same side: against chaos.
Gerber smiled, almost gently, and steepled his fingers together. “It’s simple. A man who would sacrifice his career for the sake of a child’s life is a man I believe I can trust.”
For the first time, the allusion to Mexicantown didn’t feel like an albatross around his neck.
Adam was, once again, making his way through the underground. He’d left the coat behind, and was wearing instead a beat-up hoodie, arms rolled up to expose his mechanical hands and forearms. It made him feel uncomfortably exposed, but the people he was looking for needed to see him as a fellow aug, not as ‘that weird guy in the coat’.
So far, it seemed to be working; the worst he’d run into was a muttered ‘go away’. More often, the people living down here had offered to share their fires, their food, even pointed him in the direction of unclaimed squat space. In return, he’d discreetly dropped credit chits or a bottle of clean Neuropozyne where they’d be found later. It wasn’t much, but he’d learned as a beat cop that, when all someone had left was their pride, any help he offered had to preserve that pride. That he couldn’t solve all the ills of the world. And if that galled him, he’d learned to mostly live with it.
Unfortunately, he wasn’t getting any solid leads, but he’d expected that; this had mostly been about laying groundwork. He was heading back to Překážka, working his way through one of the newly-opened areas when he heard a soft, stuttery beep that froze him in his tracks. He knew the sound of an active mine when he heard it—it wasn’t the first time he’d come across someone’s booby-trap down here, and he always took the time to deal with them before someone innocent could trip across them.
He pulled his pistol and crept in the direction of the noise. It led him through a half-height tunnel and to a door that, to his experienced eye, had recently been hacked open. As he drew closer to the sound, he also became increasingly aware of a sour-milk-and-rotten-meat stench. It was the kind of odor that felt like it was leaving a greasy film on his body, and it wasn’t hard to identify; Adam was no stranger to the smell of death.
He peered through the door. It had been a pumping room, once, and the room was still full of rusting machinery. On the far wall was another door, and his radar picked up someone moving just beyond. It was only another few seconds’ search to locate the mine, hidden where someone coming in the door blindly would trip it, blinking a steady green in time with each beep. Green—that was a gas mine. Adam was more than a little relieved—gas mines generally wouldn’t kill most people, and even if he tripped it, his rebreather filters would take care of it. Which didn’t keep him from moving slowly and carefully into the room, every iota of his attention on disarming it.
He was taken completely by surprise by the voice behind him. “Nice work. So nice that you get to choose how this goes next: walk out that door and don’t come back, or I shoot you, drag you out of here, and you wake up a day later with one hell of a headache.” Adam recognized the voice and swore, silently. Delacourt. Of all the people to run into down here...
“Pretty sure that neither of those is gonna work for me,” he said, bracing himself for another fight. She’d been beat to hell last night—what the hell was she doing down here less than a day later?
“You,” Delacourt said, in a tone of pure disgust. “What malevolent god have I offended that I have to deal with you again?” He turned, carefully, and if it hadn’t been for her voice, he wouldn’t have recognized her in the full-body disposable jumpsuit and full-face respirator. The stun gun pointed at him in an unwavering hand suddenly became a secondary concern. “No, don’t bother. Get the hell out of here. This isn’t safe.”
Adam set the mine down carefully and rose from his crouch. “What’s not safe?”
“Biohazard,” she said, shortly, “and I don’t care what augmentations you have, you don’t want to risk exposure to this.”
“It’s smallpox, isn’t it?” Adam asked, and was rewarded by a slight jerk of surprise. “Probably weaponized. Someone’s using Neuropozyne as the vector.”
“And just how do you know that?” Delacourt’s voice was almost a snarl.
He sighed. “Remember last night, I said I needed to talk to you?” He took a stab in the dark. “The information you sent to your friend Stefan got to Interpol, and the case landed on my desk.”
She didn’t lower the gun. “This had better not be some kind of trick.”
“After last night,” Adam said, “you’ve got good reason to think that. But it’s true. You can call him up and ask; he can confirm it for you.”
“Oh, believe me, I will,” she said, “after I secure this site. You—” she paused for a moment, then muttered, “Fuck, I should shoot you just on general principles. Just—stay where you are. Do not come any closer.”
“Wouldn’t dream of it,” he said, with utter sincerity. Delacourt just nodded once, sharply, holstered the Zap, and disappeared through the far door.
Adam raised his voice. “How bad is it?”
She reappeared at the door. “For fuck’s sake, will you keep your voice down? The last thing we need is to draw attention here.” There was the buzzing sensation at the edge of his awareness that invited an Infolink connection. Her foot tapped impatiently. “Pick up your damn phone.” He waited a few seconds just to tweak her, then accepted the connection just in time to hear her mutter, “Imbécile.” He didn’t need a translation for that one.
“That’s not very nice,” he said.
“I’m not very nice,” Delacourt snapped. It was odd, hearing her voice from both inside and outside.
“So how bad is it?” Adam repeated.
“Seven dead,” she said, and her voice flattened. “Decomposition’s less advanced than it was on the first group. That’s good.”
“What’s good about that?” Adam couldn’t decide whether he was curious or appalled.
“Because,” she emerged carrying a bucket, “fresher samples mean I can get more out of them. The last ones had some contamination that I couldn’t make sense of.”
“How do you plan to analyze them?” He settled on curious.
“I have ways,” she said, setting a second bucket beside the first. Even across the room, he caught a sharp scent, enough to cut through the scent of decay. It smelled like—
“Bleach?”
“Tropical-grade bleach will kill just about anything,” Delacourt said. “And for what it won’t, I have other options.” She took a stack of mines out of a box.
“What the hell do you expect to do with those?” Adam snapped.
“What, you think I’m going to just leave this here for someone else to stumble over? Not a fucking chance!” The outrage in her voice was genuine.
“You don’t have to,” he said, as patiently as he could. “I’m going to call it in and my people will take care of it.”
“Really,” her tone flattened dangerously. “So who’s your staff biowarfare expert? Or were you planning to just hand this over to a standard forensics lab?”
“We have good people,” Adam found himself defending the TF29 lab. Smiley was personally erratic, but he was meticulous and insightful in his work.
“For analysis, maybe,” Delacourt said, “but what about cleanup? Do you have anyone who knows what the fuck they’re doing with a site like this?”
“And you do?” he sniped back—he knew better, he really did, but she just got under his skin.
“This isn’t my first rodeo,” he could hear the smirk in her voice. “I’ll make you a deal. I took extra samples—I was going to pass them on to Stefan, but once I’ve established your bona fides, I’ll give them to you for your forensics team. Along with crime scene photos, everything tagged.” The smirk faded. “This time, I was prepared.”
Adam leaned on a nearby pipe. “You’re a forensics tech now?”
She sighed, theatrically. “Among other things, yes, I’m trained in forensics and crime scene preservation. I’ve done a few autopsies, too. So, relax, Detective. I’ve got this.”
“I thought you were a medic,” Adam knew he sounded puzzled, and that was probably leaving an opening for her to get another dig in, but where the hell had a medic learned forensics?
“The Special Forces medical track is… comprehensive.” Delacourt’s voice echoed oddly as she disappeared into the back with the stack of mines. “When you’re the only medical professional for a hundred miles in any direction, you have to be able to do it all. Hell, I even know some veterinary work.”
“Veterinary?” Adam couldn’t hide his surprise.
She laughed—the genuine amusement in it was another surprise. “If I never have to deliver a camel again, it’ll be too soon.” He could hear the faint beeps as she set the mines.
“You, uh, know what you’re doing with those?” The question slipped out. Modern mines were designed to be set-and-forget, but they still needed a certain level of expertise to handle safely.
“Yes,” another exaggerated sigh, “I do. Who do you think set the mine out there, fairies?”
“And what the hell was that all about?” Adam demanded.
“It did its job,” came the terse reply.
“It didn’t stop me,” he said.
“Slowed you down, didn’t it?” That gave him pause. “One of three things was going to happen. Someone smart and cautious would have walked away. Someone stupid would have set it off and they’d wake up tomorrow with a headache. And someone smart and cocky would come in and disarm it, and I’d hear it and stun them while they were distracted. Same result.”
“Huh.” Adam was grudgingly impressed. “Guess you thought that out. So why didn’t you just shoot me?”
“Gave it up for Lent,” came the snarky response. “And speaking of shooting, I want my damn sidearm back.” The non-sequitur confused him until he remembered the pistol he’d discovered under the counter. He’d stuck it in a pocket of his coat as a precaution, intending to put it back when he was done, and had forgotten it when everything went pear-shaped.
“Oh,” he said, a little sheepishly. “Yeah. Sorry. I’ll get it back to you.” Delacourt was quiet for a long moment. “What?”
“Wasn’t expecting it to be that easy,” she said drily.
“I can be reasonable.” Adam was starting to enjoy the barbed banter; there was something familiar, almost grounding about it. She could give Pritchard a run for his money. “And you didn’t answer my question.”
“Because, Detective—”
“Agent,” he interrupted.
“Agent. Because there wasn’t any reason for me to. Though you’re making me seriously re-evaluate that decision.” Adam suppressed a grin at the exasperation in her voice.
“Hate to break it to you,” he said, “but that’s not the only thing you need to re-evaluate. I wasn’t kidding when I said this is my case. I want my people to take a look at this. Tell me what precautions you think they need to take, and I’ll make sure it happens.” He gentled his voice. “Look, you called this in for a reason. It’s time to let us take it over.”
“Not going to happen.” Adam hadn’t expected anything else, but he’d had to try. “For one, you wouldn’t even have this case if it weren’t for me. For two, I doubt you have a biowarfare expert with my credentials. I don’t care how good your people are, if they don’t have that expertise, they’ll miss things.” She glared at him from the doorway. “I get protocol. You need to dot the i’s and all that to make a case. I’ll even clean the site up if your people can’t do it right. But I am not leaving this in the hands of amateurs.”
“Amateurs,” Adam repeated in disbelief.
“How many bioterrorist labs have you hunted down?” Delacourt demanded. Adam gritted his teeth and didn’t answer. “I stopped counting at 20,” she continued. “I am not letting these assholes go.”
“If that’s how you want it,” Adam said flatly. “But that means you work with me. Trust me,” he added, when she started to object, “I’m not thrilled with the idea either. But you have a point. We don’t have a biowarfare expert on board—” it cost him nothing to make the admission, and it might make her more amenable to the idea— “and you don’t have the resources Interpol can bring to bear. We both want to take these bastards down. If we work together, fewer people will die.”
“That,” she growled, “is the only reason I’m even considering it.”
Adam scratched at his beard. “Obviously, we got off on the wrong foot.” He ignored her mutter of, and whose fault was that and added, “But we still need to talk. It’ll be a couple hours while I turn this over to forensics. And you’re going to want to decontaminate. How about we have that talk over dinner?”
Delacourt stared at him for a long moment before shaking her head. “It’s gonna be more than a couple hours, and we shouldn’t discuss sensitive information in public anyway.” She sighed. “Fine. We’ll use my place—you already know the way—” Adam winced at the barb— “and I’ll handle dinner.” He could hear her smirk. “In the interests of cooperation, I’ll even forgo the strychnine.”
Adam was mostly certain she was joking. “You’re too kind,” he said drily. “I needed to cut back on the rat poison in my diet anyway.” He was surprised at her bark of laughter.
“Give me ten minutes to pack up,” she said, and there was a discordant sound as all the mines deactivated simultaneously. “And then you can call your techs.”
“You should send the extra samples you took on to your friend,” he said. “My people will be taking their own; fewer questions this way. Besides, the more eyes on this, the better.”
“Fine,” she said. She stood in the doorway, methodically wiping herself down with a bleach-soaked rag. “There’s three bonded companies here in Prague that are theoretically qualified to do this kind of cleanup work. Two of them, I’d actually trust to do it. Which means five gets you ten that Interpol has a contract with the third one.”
“Lowest bidder,” Adam agreed.
“If that’s the case, here’s what you do: you get a bunch of smoke mines. Leave the explosive charge alone, but swap out the filler with formaldehyde crystals. Seal the room off—you can do it with heavy plastic and sticky tape—and leave it for 48 hours. Then you come back for step two.” She tossed the rag into the half-full duffel that held the rest of her supplies.
“What’s step two?” Adam asked.
“Napalm,” Delacourt said, and pulled down the zipper of her suit. Adam turned away, but not before he got an eyeful of a strong, shapely body and the darkness of arm and leg augmentations. Under other circumstances, it would even have been a pleasant eyeful.
“A little warning next time!” he yelped.
“You didn’t think I was going to walk out of here in that, did you?” The squelch of damp fabric didn’t stop. “For fuck’s sake, pretend it’s a locker room if you’re that much of a prude. It’s not like I’m completely indecent.”
“I’m beginning to wonder,” Adam grumbled. “Napalm? Seriously?”
There was a wet thud. “Straight out of the Army field manuals—60 percent gasoline, 40 percent kerosene, and a thickener. If you don’t have standard-issue military thickener, you can use dish detergent and a little bit of sulfuric acid. Don’t listen to the kids on the internet that recommend sugar or styrofoam.” There was the swish of fabric followed by the metallic sound of a zipper. “Burn it to ash.”
“Is that what you did with the first site?” Adam figured it was safe for him to turn around. The t-shirt Delacourt was tugging down over a well-defined abdomen proclaimed, in big red letters:
BULLHEADED
INTELLIGENT
TACTICAL
COMPLICATED
HARDASS
He raised an eyebrow. “Making a statement?”
She bared her teeth in something far too razor-edged to be called a smile. “Fair warning,” she said. “And yes, I did.” The snarl transmuted into a frown. “There are—anomalies—about this pathogen. That’s why I needed fresher samples. And another set of eyes on it won’t hurt.”
“Afraid you’re wrong?” he gibed.
She looked at him with an expressionless face. “Afraid I’m right.”
Damn if the aggravating woman hadn’t been right, after all. It hadn’t been just a ‘couple’ hours. It had been closer to six, and he’d still ended up leaving the scene in Smiley’s capable hands. Smiley had taken one look and stared complaining that Interpol’s contractor wasn’t qualified to deal with this. “We’re going to have to kick it old school,” he’d said. “Formaldehyde in electric skillets, the whole shebang.”
Adam had spoken up. “How about smoke mines?” Smiley had looked at him, surprised, and he’d glibly improvised, “I did some EOD in SWAT, and you wouldn’t believe what people tried to stuff into them. But it should work.”
He’d had to argue both Miller and MacReady out of showing up, and it was only the reminder that the bad guys would really appreciate the local heads of TF29 and CounterTerrorism, respectively, getting themselves killed with a weaponized bug, that shut them down. MacReady, he knew, didn’t trust him; Miller, he thought, was acting more out of an excess of responsibility. In either case, it wasn’t worth the risk.
Delacourt’s comment about anomalies had nagged at him until he’d suited up— “If you’re going to throw up,” Smiley had said acerbically, “don’t.” —and took a look at the scene for himself. But she’d been right again—he didn’t know what he was looking for, and all he came out with was the burning need to stop the madmen capable of unleashing this on the world.
And then there had been Gerber. They’d exchanged a few words while the techs got set up. “Met your friend,” Adam had muttered.
“Oh, not my friend. My brother’s friend. Though she was remarkably kind to Stefan’s hero-worshiping little brother.” Remarkably kind were not two words Adam associated with Delacourt—the thought must have showed on Adam’s face, and Gerber had actually unbent enough to laugh. “Have you stepped on her toes already, Agent Jensen?”
Adam wasn’t about to admit last night’s debacle. “She won’t let it go,” he had growled in return.
“Of course not,” Gerber had replied. “Would you?” Adam hadn’t had a good response to that, and then he’d been pulled away by the techs and their questions.
Adam still wasn’t sure why he hadn’t just revealed her identity in his report, except that if someone didn’t want her working with TF29, there was undoubtedly a reason for it; it probably wouldn’t be good for the health of anyone involved if he interfered without knowing more. It seemed as if the Illuminati were pulling strings around her—even if she wasn’t a willing member, she could be a pawn. He had the sinking feeling that if he had any hope at all of figuring out what was going on around her, he was going to have to keep her alive.
It was in this unsettled frame of mind that he knocked quietly on her door. He was surprised when it opened; even though the lights were still on, it was well past midnight.
Adam stepped inside the brightly-lit apartment. His mouth watered at the scent that hit him; rich and meaty and redolent of garlic and onions, it reminded him that he hadn’t eaten in hours. At the kitchen counter, Delacourt looked toward him. “How do you take your coffee?” He hadn’t expected either the question or the courtesy, and she rolled her eyes. “I’m not a complete monster. That was a bad one.” Her eyes flicked up and down, taking him in. “You went in to see it for yourself, didn’t you? You have that look.” Her voice was brisk but not unsympathetic. “You won’t feel clean for a couple days—that’s normal.”
He’d taken the hottest shower he could, and his skin still crawled. “That’s—reassuring,” he managed. When she jiggled the coffee pot at him, he added, “Cream and sugar—lots of sugar, please.” She didn’t seem surprised by the request—but then, as an aug herself, she probably understood—and set a cup next to one of the tall chairs at the kitchen island. Adam took it as an invitation to sit, setting a box on the counter as he did. “I, uh, brought your pistol back.”
That got him the sardonic look he’d expected, though she restrained herself to a simple, “Thanks.” He’d also expected her to open the box immediately, and she didn’t disappoint.
“It’s a nice piece,” he offered. He could understand why she’d wanted it back—the Knight Tactical Compact was an older model, one of the last manufactured by Jaeger & Ritter before they’d been bought out by Steiner-Bisley, with a streamlined elegance that was sadly lacking in S-B’s current lineup—and this one had been highly customized. “A more elegant weapon,” he murmured, “for a more civilized age.”
She snorted. “Hardly. More like, a walnut stock, cobalt blue steel, and a hair trigger.” As Adam set his coffee down hurriedly, glad that he’d avoided the spit-take, Delacourt expertly checked the pistol—he’d unloaded it, of course. He didn’t miss the casual expertise with which she handled it, or the way it fit her hand like it had been made for it.
He took another sip of the coffee. That was another surprise—it was as unlike TF29’s coffee, which could do double-duty as paint stripper—as possible, and still be coffee. It had an almost spicy aftertaste; he thought he tasted cinnamon and cloves, and something oddly sweet that he couldn’t identify. Plus, she used real cream. It was something to savor. “Wouldn’t have expected you to be a fan of the classics,” he commented.
She slid the pistol into its holster and straightened. “I don’t think you know me well enough to expect anything, Agent Jensen,” she said flatly, and Adam suppressed a wince. It hadn’t just been a rebuff, it had been an indictment—one he probably deserved.
“Fair,” he said. “So how about we change that? If we’re going to work together, we should probably know each other a little better.” He meant it as a peace offering; he hoped she’d take it.
Delacourt busied herself at the counter again; when she turned back to him, the source of the delicious smells was revealed: beef stroganoff, crisp-roasted brussels sprouts, and a thick slice of some dark bread that was almost dripping with garlic butter. She slid a heavily-laden plate in front of him. “Eat,” she advised. “You don’t want to have this discussion on an empty stomach.” Even that ominous statement couldn’t dent his hunger, and he demolished the food in embarrassingly short order.
Damn the woman. She could cook, too.
Afterward, the dishes cleared and coffee refreshed, Adam couldn’t deny that his temper had improved hand-in-hand with his blood sugar. His fingers itched for a cigarette, but she was clearly a non-smoker, and he was too polite to just light up in someone else’s home.
Delacourt took her seat at the opposite end of the kitchen island. “You wanted to talk,” she said, coolly, her face an expressionless mask. “I suggest you make it good. And don’t mistake my current courtesy for forgiveness.” It wasn’t quite a declaration of war, but he was definitely on shaky ground.
“About last night…” he said, awkwardly.
“Oh, you made your opinions admirably clear. Although I admit,” she mused, “that I’m still not entirely certain of the chain of logic that led you from ‘similar augmentations’ to ‘stolen black market augs’, but I’m certain you had one.” There was no sarcasm in her voice, and it was all the more palpable for its absence. “And it doesn’t speak very highly of your opinion of my competence that you’d expect to find evidence in the open on my computer.” She took a deliberate sip of her coffee, and it was only the slightly-too-hard way she put it down that showed she was still furious. “In fact, the only reason I can think of for your sudden offer of cooperation is that, having failed to find evidence of my wrongdoing one way, you’re hoping to get it another.” Another sip. “So, please, give me one good reason not to put a bullet in your brain.” Her smile was as wintry as the grey of her eyes. “I assure you, it’ll be no trouble to dispose of the body.”
Adam didn’t think she was joking.
“Aside from the fact that you might not find it as easy as all that,” he said, carefully, “and that Interpol would certainly take an interest in my murder—” at least, he hoped they would— “what I said earlier is the truth. We have a better chance of catching these guys faster, with fewer casualties, if we work together.”
“I don’t have to work with you to do that,” she pointed out, with impeccable logic. “I can just feed the information to Interpol. I could even get Stefan to put me in touch with Hantz, now that I know for certain he’s working there.”
Adam stared at Delacourt.
Delacourt stared back.
Finally, he was the one to break. “The intel made sense. It all led to you.”
“Funny,” she observed acidly, “when all the intel leads in one direction, I start asking questions.” She fired each question like a shot. “Who sourced the intel? What’s their bias? What do they have to gain?”
Adam bit each word out. “And you gather more intel for corroboration. Which is what I was doing.” He controlled his temper—he’d play along for the moment only because he owed her something. “It should have been a quick in-and-out. I had a window of opportunity. I sure as hell didn’t expect you to come back early, beat to hell and with a chip on your shoulder!”
There was a twitch at the corner of her lips. “Obviously,” she drawled. “Your situational awareness was for shit.” Adam flushed—he didn’t need to be reminded how she’d gotten the drop on him. Twice, if he counted today. “So why the hell would someone with your background let yourself be led by the nose like that?”
Adam let both hands fall to the counter. “What the hell is this about?”
Delacourt raised an eyebrow. “I thought that would be obvious. It’s an interview, Agent Jensen. I’m demonstrating my skills—” she bared her teeth in something that could have been called a smile— “and you’re trying to convince me that I can work with you after last night.” She sipped from her coffee cup. “The question.”
“It’s personal,” Adam gritted out through clenched teeth.
“That didn’t stop you from digging into my life,” she retorted. “But we can talk about something else if you like.” Adam didn’t relax; he expected another attack, and he wasn’t disappointed. “Tell me about Mexicantown.”
Now Adam rose to his feet, a wave of fury washing through him. “You think this is some sort of game?”
Delacourt’s laugh was utterly devoid of humor. “They call it the Great Game for a reason, Agent Jensen.” The steel-grey eyes that stared coldly at him were like gun barrels leveled and ready to fire. “And if you haven’t figured it out, in this ‘game’, the points are counted in lives.” She uncoiled to her full height, matching him glare for glare. “You need my help? I need to know what kind of man you are. Tell me about Mexicantown.”
The fury evaporated as quickly as it had come, and Adam dropped back into his seat. “Mexicantown was a complete and utter cock-up.” Delacourt lowered herself back into her own seat as he continued. “There was no goddamn reason they needed to call SWAT out in the first place. It was a fifteen-year-old Hispanic kid just being a punk in the bodega square, and the only reason they called us was that he had an augmented arm and looked like he was wearing gang colors. We rolled up, and of course the kid—Dario, his name was Dario Aguilar—panicked. And he took hostages.” He rubbed his hand across his forehead. Dario’s face had still had the faint chubbiness of childhood, and his eyes had been far too young and bewildered. “The brass told me to take the shot. I tried to tell them—I could have talked to him! Could have gotten him to listen. No one had to die!” Adam buried his face in his hands.
The silence stretched; at length, there was a faint touch on his shoulder. He looked up, and Delacourt offered him a fresh cup of coffee. “Here,” she said quietly. He took a gulp of the coffee rather than say what he really wanted to; he was surprised to find that she’d laced it with a large dollop of brandy. “I… regret the necessity of putting you through that.” She settled herself in her own seat.
“Was it necessary?” he growled.
She cradled her own cup in both hands. “To see just how important this case is to you? To see how you react under pressure? To see if you were willing to give some for a greater good? Yes, it was.” One hand tapped erratically on the countertop. “My contacts are limited; there was only so much I could find out in a few hours. I had to go straight to the source.” She met his gaze levelly. “You understand that, I think?”
Adam let out a huge breath. He wished he didn’t, but given his own admission not half an hour before—he was a lot of things. A hypocrite wasn’t usually one of them. “Yeah,” he conceded. “Yeah, I do.” He ran a hand through his hair. “You do this sort of thing often?”
“I usually don’t follow dinner up with an interrogation, no,” Delacourt said drily. “But it’s not like we have a lot of time to waste.” She laced her fingers together and pressed her palms outward in a spine-popping stretch. “The window of opportunity,” she gave him a sardonic nod, “wasn’t very wide. The data will start coming in tomorrow. I had to make a decision by then.”
“Should I ask what you decided?” Adam could be sarcastic, too.
“You’re breathing, aren’t you?” came her wry response. “Besides, killing you would get blood all over my kitchen floor, and I’ve already had to clean up once today.” Adam stifled a chuckle at her mordant humor, so much like his own, and probably developed under similar circumstances. She gave him another of those unsettling once-overs. “You look like shit, Agent Jensen,” she said bluntly. “Take it from an expert: this is going to get worse before it gets better. Go home. Get some sleep. You’ll have nightmares—get some sleep anyway.”
“You develop that bedside manner in the Army?” he snarked, finishing off the coffee.
“Of course,” she retorted. “Too much time trying to get too-stubborn-for-their-own-good tough guys to be sensible and do the smart thing.”
He gave her the same kind of examination, noticing the faint pallor and the dark circles beneath her eyes, and couldn’t help but feel partly responsible. “Then let me get out of your way so you can take your own advice,” he offered, feeling awkward. “And, uh, thanks for dinner. And the coffee.”
Delacourt gave a one-shouldered shrug. “No problem.” She glanced upwards. “M, wake me up when the sequencer finishes.”
“I don’t see why,” said a cultured British voice. “With the information I have access to, I can run things 900 to 1200 times more efficiently than any human.” Adam blinked. There was something familiar about that—
“Don’t sass me, M. Just do it.” Delacourt sounded both amused and exasperated.
“Acknowledged. End of line.” The smart home fell silent.
Adam paused halfway out the door; he couldn’t contain his curiosity. “Your smart home personality—where the hell did you get it?”
Delacourt smirked. “If you’re a fan of the classics, Agent Jensen, I’m sure you can figure it out.” She gave him a semi-salute. “Tomorrow.”
Chapter 9: Shadows in the Dark
Summary:
Sloane and Adam get off to a rocky start, as their investigation into the weaponized smallpox turns up one surprise after another.
Notes:
Trigger warning for disease, specifically smallpox. It doesn't get gory, but if just the mention is a problem, then tl;dr to the end notes.
(See the end of the chapter for more notes.)
Chapter Text
PRAGUE: MAY 2029
Sloane was scribbling notes on a whiteboard when M let Jensen in. “You picked a great time,” she said distractedly, and glared at the TV screen. It currently displayed a false-color image of a weirdly jagged oval wrapped around a distinct barbell.
Jensen paused at the edge of the living room, his attention drawn by the image. “Is that—?”
“Variola major. Welcome to my fucking nightmare.” She rubbed her forehead. “Hope you didn’t come here looking for answers, because I don’t have a lot. Questions I’ve got. Answers, not so much.” There was a clear space in the living room for pacing, and she used it. She thought better on the move. “At least I can tell you where it comes from. Well,” she qualified, “its source, anyway. Specifically, I think this is a descendant of Aralsk-1971.”
“Two questions,” Jensen interrupted, “if I may.” She gestured at him to continue. “One, how do you know, and two, why is it important?”
Sloane turned to give him a measuring look. He shifted uncomfortably under her scrutiny. “For someone who doesn’t know biowarfare, those are pretty reasonable questions.” She looked around for the mouse, and finally found it in a pocket of her fatigue pants. “How do I know? I ran a genome sequence and compared it against a database of known variants.” The contents of her old storage unit had arrived a few days ago; she’d been surprised that the Army hadn’t stripped it after she went MIA, but then, they’d probably been too busy pulling out of Stuttgart when NATO collapsed. Whatever the reason, all her stored gear had still been there. Including her milspec hand-held gene-sequencer, complete with local copy of USAMRIID’s bioweapons database.
She pulled up a side-by-side comparison of the current sequence with a database copy of Aralsk-1971. “We look at the stable areas of an organism’s genetic code, the parts that aren’t under heavy selective pressure to mutate, or in the case of an engineered organism, to be mutated. This particular strand is unique to Aralsk-1971 and its descendants.” She pressed a button, and one sequence moved over the other, then began flashing green. “See, exact match.” She shot Jensen a look. “With me so far?”
He nodded. “So this variant was discovered in, what, Russia, in 1971?”
“Not discovered,” she said. “Engineered. It was based on a particularly nasty variant found in India in 1967, during the eradication effort. VECTOR had an accidental release in 1971 at the Aralsk-7 facility that demonstrated increased infectivity and a significantly higher percentage of hemorrhagic infections.”
“Like the ones we found yesterday.” Jensen sounded grim, and she couldn’t blame him.
“Like the ones we found yesterday,” she sighed. “This isn’t pure Aralsk-1971, though. Someone else has been playing fast and loose with its genome.”
“So you know where it comes from,” he prompted.
“Right. After smallpox was wiped out in the wild, there were a couple minor outbreaks caused by lab accidents. So now, officially and legally, there are two stockpiles of smallpox: one held by the CDC in the States, and one held by VECTOR in what is now Russia.” She rubbed the back of her neck. “Means it didn’t come from some unofficial stockpile in any one of a dozen nations I could name. Which,” she added hastily, “is actually a good thing. It’s not a surprise, Lermontov is dug into the Russian intelligence apparatus, but it means he’s using his existing contacts rather than branching out.”
“Good catch,” Jensen said. Now it was his turn to assess her. “You’re being very forthcoming.”
Sloane snorted and pulled the false-color image of the virus back up. “I’m a professional,” she said tiredly. “This,” she gestured to variola, the image pulsing with menace, “is bigger than any beef I might have with you. I’m not going to let people get killed because I’m holding a grudge.” She turned her head to fix him with a look of her own. And you’d better not either.
“That’s why I’m here,” he held his hands up in a placating gesture. “The forensics lab was working all night, and some of them were still cursing when I left this afternoon. I’ve got preliminary lab and autopsy results, if you think they would help.”
“Pathology?” Excitement leaked into her voice. If Jensen hadn’t interrupted her the day before, she’d have done a field autopsy, but it wouldn’t have been nearly as good as a professional pathologist’s work.
M interrupted Jensen’s reply. “Reminder.” The playback changed to her own recorded voice. “Take a break and eat something.” Then, back to M’s voice: “This reminder has been deferred four times since noon.”
Sloane started to tell M to push it off again, when Jensen casually commented, “I haven’t eaten, either. Dinner’s probably a good idea. Got a feeling there’s a lot of work ahead of us to nail these guys.” He paused, then asked, “Chinese or pizza?”
She bit her tongue on a sharp retort, instead silently telling herself that she’d set up the reminder for a reason. “Pizza. But only if it’s from Stefano’s. The Perfect Slice does not live up to its name.” Now it was her turn to hesitate for a moment, finally deciding to offer an olive branch. “They do a good Detroit-style, if that’s your thing.”
“Sure,” he agreed, easily. “I’ll make the order if you’ll make the coffee.” He gave her a wry look. “I’m only good at precinct coffee.”
Sloane made a face. “Sounds as bad as Army coffee, and I’ve had enough of that to float a tank. I’ll make it.” It was surprisingly easy. Maybe they weren’t going to kill each other after all.
Sloane was going to kill someone. None of the preliminary lab results had told her anything new, the autopsies had a disappointing lack of pathology reports, and something was throwing off her protein assays. By midnight, she was reduced to standing in front of her computer, fists on hips, growling, “You told me about the elevated levels of K7 protein two runs ago, what the hell are all these unknowns?” The computer maintained a dignified silence. She threw up her hands and turned to pace, only to stop short so as not to run into Jensen. “Fucking hell,” she snapped, “don’t sneak up on me like that.”
“Sorry,” he said, offering her a fresh cup of coffee. “So what’s the problem?”
She sipped at the coffee, tamping down her irritation at the interruption. She was out of other ideas; simplifying the problem to layman’s terms might provide an angle she’d missed. “All right,” she said slowly, gathering her thoughts. “Variola makes several specialized proteins as part of its replication process. Higher-than usual levels of certain of those proteins are an indication of weaponization. I am seeing higher levels of one of those key proteins, and signs of a couple other proteins that aren’t usually part of variola—I have to look those up—but otherwise, the assay’s throwing up a bunch of junk.” Frustration bubbled up again. “This is a reliable test. I shouldn’t be getting these kinds of results.”
Jensen tilted his head thoughtfully. “How does the test work?”
Sloane frowned. “Run the sample through a mass spectrometer and compare it to the database. Usually that’s all we need to tell us what we’re dealing with. It’s quick and dirty, but expedience rules in the field.”
“If your test is throwing unknowns,” he said thoughtfully, “that means the results aren’t in the database, right? So why wouldn’t something be in that database? I mean, what sort of things aren’t in it?”
Sloane tapped her fingers on her forearm as she thought. “Easier to say what’s in it. Considering there’s something like a hundred thousand discrete proteins produced by the human body alone, the database has to be tightly focused. In this case, proteins produced by the pathogens most likely to be used in biowarfare. Which is still a significant number.” She ran her hand through her hair. “Yeah. Okay. Good spot.” She tried not to roll her eyes at the quickly-hidden surprise that crossed his face at the compliment. “Means I have to go pull the mass spec results directly and run them against one of the big open-source databases.” Jensen looked at her like he expected her to step into the next room, and she shook her head. “I don’t keep it here—” she felt herself blanch. “Fuck, that would be a nightmare if something got out. There’s a mostly-collapsed LIMB clinic in Šrám. Nobody goes there; I set up a field-expedient lab in one of the clean rooms. The room’s still structurally sound. It’s as safe as it’s gonna get.”
“The Scar’s supposed to be barricaded off,” Jensen said, almost gently. “No one in or out. It’s all unsafe.” Šrám—The Scar, in English—had been a thriving middle-class district before the Incident, unusual only in that over 80% of its population had been augmented. The Czech hadn’t bothered trying to pacify the area during the Incident; they’d just called in an airstrike, and now the area was a half-mile long stretch of uninhabitable rubble.
“That,” she said patiently, “makes it the perfect place to put something you don’t want anyone else messing with, doesn’t it?” She drained her coffee and resumed her pacing. Jensen, prudently, stepped out of her way. Halfway across the room, she stopped and turned to face him again. “This is not a normal bioweapon. There’s too much that doesn’t make sense about it. Why the hell haven’t we seen a bigger outbreak? Variola is airborne. It spreads like wildfire. Seven victims in the last group, at least ten in the first… and we can’t do fucking contact tracing because we don’t even know who they were, much less who they talked to, but if someone else were going to get sick from contact with the first group, we’d have seen it by now. And then there’s question two: why the hell are they using Neuropozyne as the vector?” She shook her head and repeated, “Variola is airborne. For something airborne, the preferred vector is something like silica dust—a little bit goes a long way. Air currents will carry it everywhere, and it has a tendency to slice up the insides of the lungs, helps the payload get right in.” Jensen was getting a sick, appalled look on his face. “Biowarfare’s a nasty business, Agent Jensen,” she said, softly, and not without compassion. “You’re looking at the kind of people who take some of the nastiest germs in the world—diseases that are already a scourge on mankind—and make them worse.”
Sloane had the sense that Jensen was studying her behind those lenses of his. “So let’s go get the reports you were talking about, see what we can find.”
She shook her head. “Not until morning. Some things even I don’t do, and going into the Scar at night is one of them. The barricades keep people out, but there’s a few packs of feral dogs running around in there.” She ran her hand through her hair. This was the part of the job she hated—not the investigation itself, but the time it inevitably took, and the people that were going to die because of it. At the same time, running herself into the ground wouldn’t do anyone any good. “Time to knock off for the night. We’ll know more tomorrow.”
Jensen made a soft grunt of agreement. “I’m coming with you. I want to see this lab of yours.”
“What,” she gibed, “don’t you trust me?”
He gave her a long, expressionless stare through those damned shades of his. “I’m still deciding that.”
“Well, at least I know where I stand,” she muttered—but really, she hadn’t expected anything else. “Fine. Zeleň south entrance, 0900. Wear things you don’t mind getting trashed, and don’t expect me to wait.”
“Wouldn’t dream of it,” he said drily, and let the door fall closed behind him.
Sloane set a brisk pace through the Prague undercity, Jensen close behind. She’d had to take an alternate route to the Scar; it came out farther from the clinic, went through rougher terrain, and left them more exposed. It was also more indirect; after an hour of working their way through, Jensen snapped, “Is there a point to all this, or are you just trying to fuck with me?”
“Look,” she said, as patiently as she could, “le gruyère is a mishmash of storm sewers, World War II tunnels, Cold War bunkers, buried streets and catacombs from the 13th century. None of them connect neatly together—it’s a fucking maze. So yes, there is a point to all this.” By this time, she was moderately pissed. “You were the one who insisted on working together. I suggest you decide whether you’re actually going to trust that I know what I’m doing,” she got up into his face, just to show she wouldn’t be pushed around, “or go back to your nice comfy office and find some other expert.” She didn’t wait for a response; she just shouldered him out of her way and kept going.
Jensen didn’t apologize—she didn’t expect it—but his voice was more conciliatory when he spoke again. “So how much farther?”
“We’re close to the exit topside. After that, ten, fifteen minutes, assuming we don’t run into a pack. They might leave two of us alone; they might not,” Sloane said shortly. “Depends on how hungry they are.”
“Charming,” he replied. “They go after you often?”
“No.” She paused at the ladder up. “I don’t usually take this route. The other way, you wouldn’t have been able to get through.” At his frown, she elaborated. “Tight passages. I barely fit. I had to bring us the long way. If I’d really wanted to, I’d have scraped you off the first chance I got.” She paused at the top of the ladder— “From here on, ears open, mouth shut—” and carefully lifted the manhole cover aside.
One good thing about augmented eyes: she wasn’t blinded by the abrupt change in light. She took a cautious look—nothing moved but dust. Waving Jensen up behind her, she climbed out into what had once been an alley. Now, it was a small pocket amidst crumbling walls and piled rubble. She drew her pistol and moved up to the mouth of the cul-de-sac. Jensen glided up beside her with the smooth caution of a combat veteran. There was something almost reassuring about it—neither of them was entirely certain they could trust the other, but at least he wasn’t going to get her killed through incompetence.
Sloane studied the area before her carefully—this was the part she liked the least. It had been a small park, once—one of the tiny bits of green space that somehow managed to survive through the Industrial Age. The ground was torn and gouged, littered with chunks of broken concrete and rebar, cracked and buckled asphalt, the twisted remains of a wrought-iron fence, and a single half-splintered tree, still valiantly putting out a few leaves in honor of spring. The light breeze stirred up the dust, and she wrinkled her nose at the chalky scent of pulverized concrete, underlain by the heavy, sour stink of dog urine—the dogs marking their territory. Here and there a mangled prosthetic protruded from the debris, its surface eroded to the same dull grey-beige of the ever-present dust; a few feet away was a weathered human femur, long-since chewed open for the marrow.
Jensen made a soft, choked noise in his throat. “Jesus,” he muttered. It was as good a reaction as any, and summed up her own feelings quite nicely.
“Yeah,” she sighed, keeping her voice low. “They just walled it up and let themselves forget about it. Makes me wonder why I haven’t gone full-bore misanthrope.” She shook her head—and pushed the thought aside with the ease of long practice. “Anyway…” she brought up a map in her HUD, the route to the LIMB clinic outlined in green, and sent it to his infolink with a thought. “No sign of dogs; maybe we got lucky.”
“And if we didn’t?” There was no hint of sarcasm in the question.
“Go vertical, if you can, then snipe one of them as far away from your escape route as you can. Get away in the feeding frenzy.” She’d only had to do that once, but it had been a memorable occasion.
“Doesn’t seem right,” he said, quietly, and something profoundly sad lurked in his voice.
“No,” she agreed. “It’s not their fault they’re abandoned and hungry. But they’ll kill us if they can, and I’m not real eager to become dog food.” She took a moment to settle her equipment, then nodded. “Ready to move?”
Jensen nodded. “Your lead.”
“Copy that. I have point.” Taking point in hostile territory was like a homecoming. But as the two of them made their way across the blasted ground, Sloane started to get the itch at the back of her neck that told her something was wrong. The dust swirled around her feet, and the only sound was the crunch of their boots on the rubble.
The only sound—she waved Jensen to a halt about twenty feet short of the broken buildings between them and their destination. “Problem?” crackled in over her infolink.
“Too quiet,” she murmured. She couldn’t hear the dogs. Even when they weren’t in the area, the faint sounds of yips and barks and growls was usually part of the background noise. The two of them weren’t enough to intimidate a full feral pack—it would take—
“GUN!” Sloane didn’t have time to react to the shout before two hundred twenty pounds of augmented annoyance bore her to the ground. She felt the bullet hit him even before the whine-CRACK of a supersonic round hit her ears. They rolled to a stop behind a crumbling fountain, Jensen wrapped protectively around her. The heat of his body, long and lean, pressed against her like a brand, close enough to feel his heart beat in her own chest—the same steady artificial tempo, a stutter just out of sync with her own, creating a wild syncopation. The few breaths it took seemed an eternity; she could only stare up at him in shock, suddenly hyperaware of him—then more bullets spanged against concrete, and they rolled apart to crouch in the meager protection of the aging marble.
She leaned her forehead against the cool marble and took a deep breath, wrapping her hand more securely around the grip of her TCP. The texture of the grip beneath her palm, faithful old friend that it was, steadied her, and she turned her attention outward. Now that the assholes were moving, they pinged on her HUD. “I count five tangoes,” she said, in the cool, precise tone that belied the adrenaline rushing through her veins. They were using the broken buildings as cover, four on the ground and one on the second story.
“Concur. Target right,” Jensen responded curtly, and leaned out to take a quick shot at an unwisely exposed shoulder. He ducked back under cover as bullets peppered the area around him, but their focus on Jensen meant that Sloane could move, if there was someplace to move to—such as the fallen chunk of wall several feet to her left. It was barely waist-high, but she’d worked with less.
“Moving left,” she said, pushing off in a half-run, half-scramble. The sound of the gunfire changed as one or two of them belatedly reacted, switching their aim toward her, and she dove the last few feet into cover. One of the tangoes wavered between firing at her or Jensen; she couldn’t suppress a shark’s smile as his indecision caused him to turn just a little too far to the right. “Target center high,” she said, even as she pulled the trigger—once, twice, thrice, and red bloomed above his eye. He fell backwards, limbs flopping. “One down.” It made the odds a little better, though Jensen was still pinned. They needed to do something about that.
Jensen seemed to share her thought. “I can make it to the buildings if you can draw their fire,” he rasped. He popped off another couple shots to keep them honest, then pulled back and swiped irritably at a thin line of red on his cheek. Sloane’s eye fell on a chunk of concrete at her feet that looked remarkably cylindrical, and her grin widened.
“Wilco,” she all but purred. “On a three-count: one, two…” She heaved the chunk in a neat arc that would take it close to the tangoes’ cover. “FRAG OUT!” The barrage of gunfire stopped, the air was filled with Czech curses, and Jensen had a precious few seconds to make his dash. The fake-out didn’t last long, and she was waiting when they realized no explosion was coming. She ignored the two closest to her; her target was one of the two on Jensen’s side, and he popped up right into her field of fire. “Two down,” she called, and shifted her aim left. The other one on the right was a little smarter, or a little faster, and ducked back down before she could get a good shot. Now it was her turn to flatten herself behind cover, while Jensen—had disappeared.
“Well, I’ve got their attention…” she muttered, half to herself, just as one of the red triangles on her radar winked out.
“Three down,” Jensen said. “Hang tight.” She caught a flicker of movement through a shattered window, but Jensen was a shadow among shadows. The two men on her didn’t seem to notice that their buddy’s weapon had fallen silent, and she blindly fired off a few more shots just to contribute to the general racket.
The slide locked back. “Reloading,” she said, popping out the empty mag and slamming the replacement in. She peered around her cover just in time to see Jensen materialize behind the last two gunmen. It was a thing of beauty—first, an open-palm strike to the back of one man’s head, staggering him. As the other one turned toward him, Jensen pivoted to meet him with an elbow to the solar plexus, doubling him over; he hammered the other elbow down on the man’s exposed neck. Finally, a backfist to the first one, taking him down hard. It was beautiful—and Sloane had to grit her teeth against the wave of anger that swept over her.
“Clear,” Jensen said, and the silence rang in her ears.
Grimly, she gave the area a quick sweep with eyes and sensors, holstered her pistol—if she had it in her hand, she’d be tempted to shoot him—and stalked across to meet him. The faintly smug look on his face dissolved into shock as she slammed both hands into his shoulders. “What the fuck was that all about?” It was obvious he didn’t understand her anger, so she clarified. “A double-tap from cover would have done the job just as well and been more efficient. Did you really have to get fancy about it?”
His brows furrowed behind the mirror-shades. “Do you always prioritize efficiency over human life?” he asked.
“When they’re the ones that opened fire on us, yes!” Sloane couldn’t believe her ears. “Fucking hell, you don’t leave a mobile enemy to your rear!”
“This isn’t a war,” Jensen said somberly. “You don’t always have to go for the kill.” There was the faintest hint of wryness at the corner of his mouth. “And I wouldn’t call them ‘mobile’.”
She took a couple steps away, rubbing her temples with one hand. “Fine,” she muttered. “This isn’t the time to argue about it anyway. Anything on them that suggests why they’re here?”
“Weren’t you the one who said nobody comes into the Scar?” Jensen didn’t even bother to hide the snark.
She whirled back around. “Yes,” she said tightly. “I did. I’ve never seen indications that anyone comes this deeply in. There’s some people who scavenge the outskirts off and on, but half these buildings are about to come down. Between that and the dogs, it’s enough to scare most people off.” She scowled. “Not to mention the stories about it being haunted.”
“Haunted?” Jensen’s eyebrows nearly climbed up into his hairline.
Sloane snorted. “Yeah. You can’t go ten feet in this city without coming across some medieval horror, or a former pagan site. Prague is the home of the Golem… and of Dr. Faustus.” She looked out over the shattered cityscape.
“Oh-kay,” Jensen said, in a tone of disbelief, while Sloane crouched beside one of the bodies, giving it a cursory pat-down. The stink of blood, brains, and released bowels was almost palpable, but it was a familiar smell, one she’d trained herself to ignore. He wasn’t carrying more than some 9mm ammunition for his cheap-ass machine pistol and an almost empty credit chip.
“Can’t really blame people,” she said absently, as she rose from her crouch and moved to check another body. “They see weird lights—probably from broken gas mains—they think about how many people died here, mad, unburied, unshriven… Will o’ the wisps are supposed to be the spirits of the wicked dead.” The second body was as unforthcoming as the first; she brushed the dust off her pants as she straightened. “Makes a weird sort of sense.”
“Hunh,” he said, kneeling by one of the gunmen he’d taken down. “I’ll keep that in mind.” A quick, expert pat-down, and he shook his head. “Nothing. Gang colors, but I don’t recognize the combination. Must be small-time.”
“Yeah,” Sloane frowned. By this time, the adrenaline had faded, and she had calmed enough to see the merit in Jensen’s earlier comments—and the unfairness of her own. She didn’t usually let her temper loose like that. “About earlier... My training is that when I get shot at, I shoot to kill. I’m not going to apologize for that. But I shouldn’t have chewed your ass for the way you handled it.” She took a deep breath. “Especially after you saved mine. Thank you.”
“Don’t sweat it,” Jensen said, and this time she could definitely hear the wry humor in his voice. “And… jackpot.” He held up a p-sec from the second banger he’d taken out. He popped it open, scanned it briefly, then tossed it to her. “Look familiar?”
She stared at it for a moment, then swore.
FW: DATAFILE
To: Lukáš Procházka
From: ликвидатор один
Find the source. Deal with it.
=================================================================
From: [email protected]
scrape.strt:.[ntwrk/BlackWeb.net]c3a0:2bec:c078:5312:e3f1:7947:aa35:7ce7RE:
Variola Major Analysis KNOWN CODON IDENTIFIED
GTGAGCAACGAAAGCCTAAACGGGAAATACGCGGCCAAAAGTCGGTGCGAATACGAGTCGTAGCAATGTTGGTC
TGGCTATGATCTACATATTTCAGGCGGTACGTCTGCTCTGGTCAGCCTCTAATGGCTCGTTAGATAGTCTAGCC
GCTGGTAATCACTCGATGACCTCGGCTCCCCATTGGTGCTACGGCGATTCTTGGAGAGCCAGCTGCGATCGCTA
ATGTGAGGACAGTGTAATATTAGCAAGCGATAAGTCCCCAACTGGTTGTGGCCTTTTGAAAAGTGAACTTCATA
ACATATGCTGTCTCACGCACATGGATGGTTTGGACAAATTTGATTCAAGTCTGATCAACCTTCACATAGAATCA
AAAGCAGTGATCTCCCGGGTGCGAAATAAAAATACTAGGTAACTAGAGGGACTGCGACGTTCTAAACGTTGGTC
CGTCTGAACCGCCATCCAGGATCACGTCG&%$$$scrape.ret.terminated
“BlackWeb has military-grade encryption,” she said tightly. “How the fuck did someone scrape this?”
Jensen frowned; it seemed more thoughtful than anything. “I can look into that, if you don’t object. Discreetly.” He held a hand out.
“Well, this confirms one thing: ‘Liquidator One’—Lermontov—is keeping eyes on his experiment.” Sloane tossed it back with a frown. “And he doesn’t want it getting noticed yet.” She gave Jensen a look. “Hope your people have good OPSEC on this.”
“Need-to-know,” he reassured her. He tucked the p-sec into a pocket. “And—” His brows furrowed and he got the head-tilt of someone receiving a private call on their infolink. He held up a finger with an apologetic look; she nodded and busied herself double-checking the area. They’d caught her off-guard once; she wasn’t going to let it happen again.
Jensen’s boots crunched on the rubble behind her. “I need to go into the office. Forensics has some results,” he said. When she turned, his brows were furrowed again, and he was regarding her like a puzzle where the pieces he’d thought fit turned out to be in the wrong places. She wondered what he was thinking—and then wondered why she cared.
“Watching me run assays is boring, anyway,” she replied. “Not a problem. We can meet back up tonight to swap info.” She tapped her fingers on her thigh, thinking. “Can you find your way back?”
He nodded. “Map’s updated; shouldn’t have a problem.” A brief nod, and he turned to retrace their steps, while she headed for the LIMB clinic. By the time she got there, she’d almost succeeded in forgetting that one searing moment…
These late nights were becoming a habit, Sloane thought as she climbed up the stairs. One assay had turned into—she’d lost track after five, as the results became more and more unbelievable. Hell, she still didn’t want to believe it. “What the fuck is he thinking?” she muttered.
“What is who thinking?” The gravelly voice behind took her completely by surprise, wrapped up in her thoughts as she’d been. Reflex took over; she was in his space, knife to his throat, before her brain finished recognizing the voice. Jensen was sensible enough not to move—she kept her blades very sharp.
“Are you fucking crazy?” she snarled, before taking a deep breath and bringing her jangling nerves to heel. “Don’t do that. Just… don’t.” She stepped back, sliding the knife back into its discreet sheath.
“Sorry,” he said, holding his hands up in a gesture of apology. “Figured you’d heard me.” Sloane closed her eyes for a moment, letting the fight-reaction ebb. Situational awareness, you fucking idiot! “No,” she said, her breath coming just a little harder than normal, “and I should have. Did I nick you?”
“Even if you did,” he said, with a hint of wry humor, “I’ve had worse shaving accidents. Should’ve realized you’d be on a hair-trigger after this morning.” The finicky corridor light decided to flicker on, and he frowned. “To borrow your own turn of phrase, you look like shit. You didn’t stop to eat, did you?”
She hadn’t. It had been a running gag among the team—Jablonski liked to prank people with his bizarre jellybeans, Shelby’s love of chicken a-la king MREs was purely unnatural, and Delacourt tended to get wrapped up in what she was doing and forget mundane things like food. It wasn’t Jensen’s fault that his comment—so like the teasing of her teammates—dragged the memories up from their unquiet sleep to twist like broken glass in her heart. “I’m fine,” she said, more harshly than she intended, knowing it for a lie.
She turned to lean on the balustrade, staring unseeingly into the darkness. She wasn’t fine—Lermontov’s re-emergence into her life had thrown her off-balance, exposed the still-gaping wounds of her loss, all the things that she’d papered over and pushed aside in the immediate struggle to claim this new mechanical body as her own. Lermontov—just the thought started a conflagration in her soul that would only be quenched by his blood. “Start running, you bastard,” Sloane whispered, hand clenching on the frail metal of the railing. “I’m coming for you.”
“What was that?” Jensen folded his arms across his chest; she could feel his scrutiny even through the shades.
“Just… thinking out loud,” she said, more-or-less naturally. “What have you got?” She didn’t want him in her apartment tonight, not as raw as she was, when the peace between them was so fragile.
“Forensics thinks the weird results they’ve been getting were due to contamination of the crime scene. They can’t make sense of what they’re seeing.” Jensen came over to lean on the railing an arms-length from her.
She exhaled heavily. “They found prions?”
She sensed more than saw him turn his head to look at her. “You knew?”
“I spent the last fourteen hours running tests because I couldn’t fucking believe what I was seeing. No, I didn’t,” she said levelly. “If I’d known, I’d have said something earlier.”
“The big question,” Jensen said, “is why. My people don’t have any theories.”
“That’s because it’s—it’s insane, is what it is,” Sloane dug her fingers into her temple to try to release the band of tension around her head. “At first, I thought it was just an artifact from culturing the virus—they may not have access to a full-scale biolab. I found some enzymes native to pigs in the Neuropozyne, so they may be culturing in vivo. There’s no known prion diseases of pigs, but that doesn’t mean they don’t exist. So I infected a live tissue culture with a sample of Prague-2029 and measured the prion levels before and after initial viral amplification.” Her shiver wasn’t due to the chill night air. “Remember I said someone’s heavily engineered this thing? Along with the usual proteins it makes to hijack cells, it creates prions.”
“Okay,” Jensen prodded, “but how does that bring us to ‘why’?”
“I can think of two possibilities off-hand,” she sighed. “One, this is a proof-of-concept to see if it’s possible to get an infectious virus to create prions, and they’re using smallpox because it kills quickly and they think no one will be looking beyond ‘smallpox’. I’ve seen weirder logic, but that’s still the one I’m leaning toward—frankly, the other possibility…” She shook her head.
“Which is…?” Jensen’s voice was a mix of curious and impatient.
“It’s a time bomb. A poison pill, if you will. Any competent lab can whip up an mRNA vaccine these days. Smallpox… there’s pathogens out there that are a lot more dangerous, but smallpox has a reputation. It’s like a—a—charismatic predator of biowarfare. So there’d be a lot of focus on propagating the vaccine. Lermontov, or whoever he’s got culturing this, has to know this. A lot of people would die, but it would be containable.” She took a deep breath. “This—like I said, it’s insane. No one ever seriously considered that someone would use prions as a biowarfare agent, because the incubation period is measured in years—decades! There’s no vaccine, there’s no cure, which means you can’t protect your own people from it—even by the standards of people who think biowarfare’s a good idea, this is lunatic!” Sloane kept her voice down by sheer force of will, but it was an effort. “Population dispersal alone would keep it from being a viable area-denial weapon.” She pushed herself away from the railing to pace. “There’s no endgame that I can see.”
“What if they could speed up the incubation period?” he asked, digging in a coat pocket for something. “That would make it a better weapon?” He fished out a slightly battered Kočičí Jazýčky bar, offering it to her without comment. She took it, equally without comment, but with a wry, apologetic twist of her lips.
“It might,” she said, breaking off a few pieces of chocolate and popping them in her mouth. “You’d have to really speed it up, though. I’m not a microbiologist or a protein specialist, you understand…” he nodded, “so what I know is mostly from journals.” She pulled together what she knew as she finished off the chocolate. “Known prion diseases are usually transmitted through ingestion.”
“Like mad cow disease?” Jensen leaned back on the railing.
“Exactly. Or kuru. Specifically, you get it from eating infected brain or spinal tissue. There’s theories that if you blast the intestines with a super-dose of prions, that’ll speed up the—” Sloane stopped short as the connections formed within her mind. “Son of a bitch, that’s it!” Jensen was looking at her like she’d gone crazy. “I just figured it out,” she said, speaking rapidly, hands gesturing to emphasize her words. “Why smallpox. Why hemorrhagic smallpox. The prions need to be delivered to the intestines. Hemorrhagic smallpox attacks the organs. Spleen. Bladder. Liver… Intestines. Maybe even if someone gets vaccinated; hell, if they want to be really vicious, engineer the damn thing so that the vaccine includes the prion-generating RNA.” It made the chocolate sit heavily in her stomach. “You could have a whole population come down with dementia-like symptoms—think of the damage that could do!—and it’s ultimately one hundred percent fatal.”
The eyeshades couldn’t hide the sickened look on Jensen’s face. “That’s—” he seemed to fumble for words— “monstrous.”
“Yeah,” she said. “I can guess what he plans to do with it, too.” At Jensen’s sidelong look, she elaborated. “Lermontov’s a hard-line Russian nationalist. He wants Russia to have the same sort of territorial reach that it did during the Cold War. So…” three steps, turn, three steps, “so… the vector is Neuropozyne. That’s not an accident, either. Lermontov despises human augmentation. Thinks it makes people weak. Now, this variant amplifies fast and kills fast. That’s deliberate. Like I said, it’s a proof-of-concept. I think they’re still tweaking the lethality and the incubation period.” The words tumbled out as Jensen just stared at her. “Augs are ghettoized these days. Homeless, crowded, unsanitary, the perfect breeding ground for an epidemic. It starts with the augs. But augs aren’t completely contained, there’s enough commingling that it spreads to the rest of the population. Burns through places like Útulek and the Glasshutte. No one cares, everyone writes them off. Hell, you maybe even get a repeat of last year’s riots. Meanwhile, nats get the vaccines and the hospital care that lets them survive. The epidemic gets contained, everyone pats themselves on the back, the Aug problem is unexpectedly dealt with, job well done. And no one is looking for a prion disease because they’re too busy dealing with the smallpox.”
Jensen rasped, “Like a magic trick. Look at what my right hand is doing.”
Sloane nodded. “Exactly.”
“That’s making a lot of assumptions, though,” he said thoughtfully.
She stopped an arm’s length from Jensen. “I know Lermontov,” she said quietly. “I did the intel on him for the Chechnya raid.” Grief wrapped around her heart and squeezed, but she did her best to ignore it. “He’s a lot of things: sadistic, megalomaniac, and rabidly nationalist, but he’s not stupid. He knows how to break people.” Like me. She turned away to stare out into the darkness again. “It’s not a huge jump from breaking a person to breaking a society. Especially when the society is already fractured.” Her hands curled around the railing. “We have to find him. And stop him.” And kill him.
Jensen drifted up to the railing next to her. “We have a couple other leads,” he said quietly. “I talked to someone about the web scrape.” His mouth twisted in a disgusted scowl. “Did you know that Tarvos Security purchased BlackWeb last year?”
“What?” Sloane stared at Jensen in disbelief. “No! If I had, I sure as hell wouldn’t have used them!”
He nodded grimly. “It was never publicized.”
“After Rifleman Bank Station,” she growled—she’d read the news reports, and, knowing how to read between the lines, could guess at just how bad it had really been— “if it had been publicized, users would be leaving in droves.” She turned her head to look at Jensen, who was gazing intently down into the darkness of the courtyard. “I wish I could buy a drink for whoever exposed that festering pustule.” She thought Jensen gave her an odd, sidewise look, but it was hard to tell with the shades. Her own gaze turned outward, her voice dropping to a bare whisper. “It was a Belltower pilot that got us shot down. He claimed it was engine trouble, before he bailed, but…” She shook her head tiredly. “I didn’t believe it. Not once I was able to actually think it through. If I’d known…”
“According to my source, Tarvos sells decryption keys to whoever can afford them. Mostly the major players. The Dvali, the Jinn, other mercs, corps, intelligence services…” Jensen matched his volume to hers. “Almost certainly, the Russian intelligence apparatus.”
Sloane nodded. “Lermontov’s got contacts. Hell, he may still be an active GRU agent on a real long leash, deniable and expendable.” She exhaled heavily. “Explains how he got the intel. Someone here’s keeping an eye on the chatter.” Her fingers went to her temple again. “Any more good news for me?”
“Just one,” he said. “Did you know the samples were mildly radioactive?”
She turned, slowly, to face him. “Radioactive?”
“Yeah,” Jensen held out a pocket secretary. “What do you make of that radiation profile?” He had an odd, almost expectant expression on his face.
Forgetting her headache, Sloane grabbed it. “Cesium-137… strontium-90…” She looked back up at him. “Chernobyl. Hell, it’s even right there in their fucking name.” She handed him back the p-sec. “From these levels, maybe even in the power plant complex itself, though I sure as hell wouldn’t want to set up shop there.” Chernobyl. She had a direction, at last. Excitement fountained up, washing the exhaustion away in a gout of temporary energy.
“That’s our analysts’ take on it, as well,” he said. “Which leaves TF29 with a problem. Russia is a signatory to Interpol, but not to TF29. Separate charter. So if we send a team in, and they get caught, it would be our asses.”
Sloane’s mind spun rapidly. “Good thing I don’t work for TF29, then.” She turned toward her apartment, already making plans.
“How did I know you were going to say that?” Jensen sounded exasperated. “I’ve already arranged tickets to Kiev. We even have time for a little shut-eye.”
She paused mid-stride, turned back. “You what?”
“TF29 can’t send a team in,” Jensen said patiently, “but they can send one man, discreetly, with a background in investigation.”
She felt her eyes narrow. “You said tickets. Plural.”
“Technically, your buddy Stefan arranged for the other ticket.”
Sloane frowned. “Stefan isn’t my buddy.” Her relationship with Stefan was infinitely more complicated than that, and certainly wasn’t something she wanted to discuss with Jensen. “What exactly did he arrange?”
Jensen tossed her a pocket secretary; she plucked it neatly out of the air. “Something about an off-the-books consultant.” He was smirking now. “You’re not scraping me off that easily.”
She glared at him. “You’re a real asshole, you know that?” She tapped the p-sec against her open palm. “What’s the cover?”
“Freelance bodyguards, run out of Prague after our employer dropped dead unexpectedly,” Jensen replied.
“Uncomfortably plausible,” Sloane said. “Next best thing to mercs, but there’s so many of those around two more won’t draw notice. I presume the e-ticket’s on this?” She waved the p-sec; he nodded. “Fine. I’ll review the legend and meet you at the train station.”
“Don’t be late,” he called after her. She flipped him off without looking back, and his dry chuckle followed her.
Notes:
TL;DR: Adam and Sloane, uneasy partners, discover that something is off about the sample recovered from Chapter 8. They venture into an abandoned part of Prague where Sloane has hidden a biolab for safety's sake, only to be ambushed along the way. Adam knocks Sloane out of the way of a bullet, much to her surprise, and the two of them deal with their adversaries in different ways.
A pocket secretary on one of the attackers referenced data sent from Sloane's lab; unknown to Sloane, the secure service she used had been secretly purchased by Tarvos, who sold the encryption keys to anyone who would buy them. Lermontov had picked up a scrap of the transmission and hired a local gang to deal with the problem.
The sample, more fully-researched, provided more insight into the nature of Lermontov's plan. The Neuropozyne bottle turned out to have a radiation profile that corresponded to Chernobyl. The pair are off to Kyiv, to further investigate...
Chapter 10: Of Silk and Steel and Blood
Chapter Text
KYIV: MAY 2029
On the surface, Kyiv was a triumph of the modern world, a crossroads where north met south, east met west, the anchor of the reborn Silk Road. It was a center of art and technology that opened its arms to tourists and tradesmen alike, where glittering towers of glass and metal spired over basilicas of stone. But beneath the glittering surface were currents far more dangerous than those of the Dnieper, where the Dvali and the Solntsevskaya Bratva struggled to become the dominant Eastern European criminal organization, the Jinn took advantage of the infighting, and a host of lesser scavengers fought over the scraps.
It was a good place for people like Walther Franks and his partner, Evangeline Broussard, to go when they ran out of options. The professional bodyguards—mercs, to be brutally honest—had been forced to leave Prague in a hurry after their employer died under mysterious circumstances. There was no lack of employment in Kyiv, so long as one wasn’t too particular about where the money came from. Even for the augmented: it wasn’t that there were fewer restrictions to deal with; it was just much easier to buy your way past them.
There was an old saying that if one had guns, one could acquire money. In Kyiv, the inverse was just as true, and convenient for people like Walther and Evangeline, who’d rather go without clothes than without weapons. The need to correct their temporarily unarmed condition had led them to a grubby apartment on the wrong side of the river, where the only thing exchanged was credits, and where anonymity ruled. And that, Walther thought, as he flipped through the dealer’s inventory screen, was just as well, because all hell would break loose if anyone here discovered that Walther Franks, mercenary, was actually Adam Jensen, agent of TF-29.
Of course, that wasn't the only reason for all hell to break loose, as the commotion around his partner showed…
“What did you say?” The edge in Evangeline’s voice was nearly as dangerous as the edge of the blade she had pressed to the neck of one of the enforcers.
“Wasn’t talking to you, bitch!” he snarled, and his eyes desperately searched for— “Hey, get your woman on a leash, will you?”
“Think she might object to that,” Adam said, coolly. “Problem, Eva?” Evangeline was a deadly woman, but as covers went, she was a very thin skin over the even deadlier woman beneath.
“He seems to be a little confused about the nature of our partnership,” Sloane Delacourt—currently, his partner of necessity—replied in a deceptively agreeable tone, a faint French accent underlying her words. “‘How much for this bitch’s ass,’ I believe he was asking.”
“She’s not for sale,” Adam said dismissively. Walther wasn’t the type to waste time on people too stupid to live, and crossing Delacourt—whatever guise she wore—put someone fairly high on that list. Underneath the façade, Adam kept a careful eye on the situation. He’d figure out a way to intervene if he had to.
“Everyone’s for sale,” the idiot in question managed to get out, and then shut up as the blade pressed harder into his skin. She was using the flat rather than the edge, so she hadn’t drawn blood—yet.
“Is that so,” Delacourt all but purred into his ear. “In that case, since I have your life in my hands, how much will you pay me for it?” A slight flex of her wrist, and a few bright beads welled up along the knife’s length. “Right now, it’s a seller’s market.”
“You might want to apologize,” Adam made it sound like he didn’t care one way or another. “The last time someone made that kind of mistake, it got messy.” He let his gaze rake across every man in the room. “I don’t like messy.” The tension ratcheted up in the room, as the other enforcers got just that little bit more on edge.
“I apologize for Valentyn,” Bondarenko gritted out. “My son is young. Sometimes he loses his head.” He gave Adam a hard look. “Of course,” he said a little too loudly, “we wouldn’t want to upset the customers.”
Adam raised his eyebrow. “Of course not.” He glanced back up at Delacourt. “Work now, play later, Eva.”
Delacourt let the boy go, ostentatiously cleaning the knife on his t-shirt before she gave him a rough shove toward the back of the room. She sauntered over to the counter next to Adam and leaned on it menacingly. “Nice knife. Good edge,” she said. “I’ll take two more.”
Bondarenko silently placed them on the counter next to their other purchases. Adam peeled off a couple more credit chips to cover them while Delacourt made the knives and half the guns disappear. As if they did it every day, she slid to the side, protecting him while he armed himself.
“What now?” he asked, as they emerged into the clear, dark night.
She placed a finger over her lips. “You said you wanted to let off some steam; back to Shevchenkivs’kyi?” she said, a little too loudly, jerking her head in the opposite direction.
“Works,” he said shortly, and moved in the direction she indicated. The reason for her caution became apparent at the sound of angry voices behind them. “Of course they couldn’t let it go,” he sighed in exasperation, ducking into an alley before they could be spotted.
“Probably not just that,” Delacourt tossed over her shoulder. “There’s only two of us; they figure they can take us out, and then they get both the weapons and the credits.” She led him through a maze of increasingly narrow back streets, obviously looking for something. “Too bad they’re doomed to disappointment.”
“Not the time for jokes, Eva,” Adam put an acid edge on the name. “We’re trying to be subtle here, remember?” He followed her into the narrowest alley yet and stopped short before he ran into her. It was barely wide enough for the fire escape on one side. It was also a dead end. He took a quick glance at the fire escape—the ladder was raised, too high to jump. Behind them, the pursuing voices grew louder. “Great,” he grumbled. He turned to face the alley’s mouth and braced himself for a fight, rolling up the sleeves of his battered sweater. He missed his coat and its magnetic sleeve vents, but it was too distinctive for covert work.
“O ye of little faith,” she chided, sounding far too cheerful for the situation. He glanced behind him just in time to see her take a short running jump onto the wall; she was twisting in midair by the time her feet hit, and sprang off only to hit the opposite wall a few feet up. Twice more she repeated the jump, then made one final, two-footed leap and caught the railing of the fire escape. There was a rattle of metal as she pulled herself up and over, and then the ladder creaked slowly down.
When he reached the landing, she had an absolutely shit-eating grin on her face. “What the hell was that?”
Delacourt smirked as she cranked the ladder back up behind him. “You really need to learn to think outside the box, Wally.” She secured the crank. “C’mon. Let’s get to the top before they figure out where we’ve gone.” She ran lightly up the fire escape, as if it was something she did every day. Hell, from what he’d seen, it probably was.
Adam gritted his teeth and followed in the maddening woman’s footsteps.
She led him on a wild scramble over Kiev’s rooftops, going up and down, flinging herself over gaps he wouldn’t have dared on his own, catching herself on pipes and fire escapes and even the occasional electrical cable, things he would never have thought would hold under his weight. It was both exhilarating and aggravating. Exhilarating, because he couldn’t deny the adrenaline rush he felt while leaping a gap ten stories up—the Icarus didn’t mean much to instincts that screamed ‘too high!’—or the cool pleasure of the wind on his face, tugging at his hair with playful fingers, or the genuine beauty of the panorama beneath him. And aggravating, because it was obvious she was slowing down for him. Once or twice, he’d seen how she checked herself, took a different, easier, path, and he knew it was for his sake. Even so, he’d misjudged a jump once; she’d been there to catch him, pulling him back up with a steady strength that he didn’t think was due solely to her augmentations.
She finally came to a halt at the edge of a building about twenty stories up, where urban jungle turned into a more decorous sprawl. Arms akimbo, wind-swept hair, one foot on the parapet, she looked a modern-day Anne Bonny, bloodthirstiness and all. She turned as she heard his footstep behind her; sparkling eyes and a wide, piratical grin did nothing to dispel the image. She was breathing a little heavily, he noted, and was obscurely relieved that he wasn’t the only one that was winded. “I think,” he said, heavy on the irony, “we lost them.”
“If we didn’t,” Delacourt said cheerfully, no hint of the French accent, “we sure as hell made ’em work for it.”
Adam came up beside her, folding his arms. “Now that we’re clear, what the hell was all that about back there?”
She didn’t pretend she didn’t know what he was talking about; the grin dropped off her face and her arms fell to her sides. “I’m a woman,” she said flatly.
He raised his eyebrows. It wasn’t something he thought would be in question; despite the hard, athletic muscles and powerful build, the curves of her body were undeniably (and not unappealingly) feminine. “Pretty sure I knew that.”
Delacourt looked up at the sky as if asking for patience. “They didn’t ask if you were for sale,” she clarified, that dangerous edge seeping back into her voice. Adam inhaled sharply as her meaning became clear. “Yeah,” she said. “Now you get it.” She folded her arms behind her back, parade-rest-style, pirate transformed to something decidedly more martial. “I needed to demonstrate that I wasn’t meat. That I was capable of killing every single one of them if they even looked at me funny. Otherwise they’d have been on us before we walked out the door, instead of hesitating just long enough to give us an out.” She ran a hand through her hair, flipping the disordered locks more-or-less back into place. “You backed me up, regardless.” A faint hesitation, then, “I appreciate that.”
Adam let out a long breath, feeling slightly ashamed. He’d chalked her actions up to a hot temper, wounded pride, and hadn’t looked beneath for deeper motives. She was right, of course—he’d had an iron-clad rule against hazing in Team Two—and he’d known, despite his best efforts, that it happened anyway. He glanced sidewise at her profile, the moonlight throwing her features into sharp relief. That she had a fierce temper wasn’t in question; a daredevil streak, undeniable. But he was beginning to think that her impulses didn’t rule her, but the opposite; she wielded them with the finesse of a surgeon’s scalpel. Adam wasn’t a man to be turned by a pretty face, but the complexities of her character intrigued him.
The silence between them stretched out just that bit too long. “No problem,” he said hastily. He stepped up next to her. Hell of a view. He thought about the surety and confidence she’d shown as she led him from rooftop to rooftop. “You do this sort of thing often?”
“Every chance I get,” she admitted. “Takes some practice, but the results are worth it.”
Adam raised an eyebrow. “I take it we’re meant to head back to ground level here?” The nearby ladder down was a strong suggestion, though it looked more than a little precarious.
She made an affirmative sound. “Though I think we’re going to be taking the direct route. That ladder’s definitely not up to code.”
“The… direct route.” Did she mean what he thought she meant?
Delacourt’s face broke into a sharp, fierce grin. “One way express elevator to hell, going…” She jumped, pirouetting in midair to face him. “Down…!” Golden light blossomed below him, and the faint scent of ozone drifted up.
“That’s what I thought,” he sighed to himself, trying to ignore the little voice in the back of his brain—the one that sounded like a much younger him—that reminded him that being able to jump off tall buildings and land in one piece was really, really cool.
What the hell. Adam stepped off the edge and let gravity take over.
The living room of the safe house was a mess of empty takeout containers, scattered gun parts, blueprints, and the occasional p-sec. Delacourt absently rubbed a cloth over her new pistol’s receiver; despite her outward relaxation, she still managed to radiate an air of leashed energy. The lion’s share of her attention was on the map currently displayed on the TV.
“The Chernobyl Museum,” she said. “As we saw during our visit earlier today, an extensive collection of historical records, artifacts, and media dedicated to the 1986 meltdown. Charming, engaging, educational, doesn’t tell the half of it, but then again, neither did the Soviets. Now, one might mistake the extra security cameras here, here, here, and here—” she highlighted them on the display— “as relics of the Cold War, there for ambiance.”
“They’re live.” Adam had noticed that himself. “At first I thought it was a little too much security for a museum, but maybe they’ve got some radioactive artifacts that need to be protected. Or the public needs to be protected from them.”
“Smart man,” Delacourt replied, entirely without sarcasm. “That’s the second layer of obfuscation, meant to divert someone exactly like you. The right hand says ‘stay out’, and the left hand gives you a reasonable explanation why you should. And that is because, right next door, not labeled on any maps, are the offices of the KGB unit attached to the Ministry of Emergencies. They’re the ones that do all the background checks on people going into the Exclusion Zone. Which means, if we want to look like legitimate visitors, we need to get in there. Plus, if Lermontov’s left any trace of what he’s doing in the records, they’d probably also be there.”
Adam gave her a hard look. “And you didn’t mention this before… why, exactly?”
“Because I was only about seventy percent sure that was the case,” she retorted. “Some of my intel’s a touch of date, and following up via official channels was likely to get us blown, if you recall?” She set the receiver aside, got up, and started to pace around the room, hands moving vigorously to punctuate her words. “I needed to do the initial footwork to know what the next step was.”
“Uh-huh,” he said. Their earlier moment of camaraderie now seemed suspect; his next words came out without him really thinking them through. “And you’re sure it wasn’t about doling out the information so I have no choice but to keep you on this case?” Adam had no patience for being dangled at the end of a line. He had to put up with it from the Collective and from TF-29, but damned if he would take it from Delacourt.
Delacourt went stone-still, the laughter of a few hours ago gone as if it never been. “I bring enough to the table that I don’t need to play those types of games, Agent Jensen.” The face she turned to him was expressionless—except for her eyes. Those seethed, dark and angry. “I’m curious to know what led you to that conclusion.”
“I don’t like being kept in the dark, Ms. Delacourt,” he snapped. “If we’re going to work together, I need to know that you’re being up-front with me. And that means not holding on to information until you think it’s necessary. Not least of which because if you take a bullet to the brain, you, me, and the mission are all screwed.”
She closed her eyes and took a deep breath. “That’s a valid point.” Adam couldn’t hide his surprise at her ready admission. With tightly controlled movements, she walked over to the couch, typed her password into her laptop, and slid it, still open, over to him. “There’s a copy of all the data I’ve pulled together.”
Adam put a hand on the laptop. “Why wait?”
Delacourt gave him an unreadable look. “There’s three ways to do something: the right way, the wrong way, and the Army way. Welcome to the Army way: compartmentalize and minimize need-to-know. As you just pointed out, that’s not viable on a two-man mission with minimal external support. I—hadn’t taken that into account.” Her voice dropped on the last word. “Won’t happen again.”
He studied her critically. She seemed sincere enough, but a little niggling prod from somewhere beyond his conscious grasp made him question it. “Guess we’ll see about that.”
The only sign of her anger was a faint glow in the copper rings of her eyes. “I get it,” she said levelly. “You don’t like me, you don’t trust me—why doesn’t matter. What matters is that just a couple hours ago, you were willing to extend enough trust to follow my lead. Now, you’re not. Fine.” The way she bit off the word, it was the exact opposite, but she wasn’t finished. “Just do us both a favor and pick one, so I know if I need to watch my own back.”
“And if it’s ‘not’?” he challenged her.
She sighed in exasperation. “Then believe that I want these people shut down as much as you do. I want them stopped. I want their bioengineered atrocities destroyed. I want their ability to make those bioweapons to go the way of fucking Carthage.” She shook her head, turning to pace. “Or believe that if I were going to sabotage your investigation, I’m smart enough to have done it back in Prague. Fuck, Jensen, I’m the reason it got to your people in the first place!” She stopped, back to him, one hand braced on the entryway to the kitchen, head bowed.
“Little bit of an inconsistency there,” Adam pointed out, unable to quell the urge to needle her, find out what made her tick. “First, you want it off your hands, then you can’t let it go. As you said… pick one.”
Delacourt spun around as if stung. “I didn’t want it off my hands. If I’d had the resources to follow up on it myself, without risking lives, I would have. But I don’t. One burned operator isn’t gonna cut it. Not against Lermontov.” She glared at him. “And if Interpol had assigned an actual team to it—someone with biowarfare experience, for fuck’s sake—I’d have let it go. But they assigned…” her gaze raked him up and down, and it was clear he didn’t measure up to whatever standard she was using, “you. Maybe you’re good enough to do it on your own. I don’t know.” She ran her hand through her hair, unhappy lines carved between her eyebrows. “I can’t take that risk. I let him slip through my hands once. He’s my responsibility.”
“You let him slip through your hands,” Adam pressed. He had the feeling he was getting close to whatever truth she hadn’t been telling him. “Sounds pretty specific. Not your team—you.”
She folded her arms stubbornly, her gaze focusing somewhere on the floor to his left. “I gave him that scar.”
“I thought your plane went down with everyone aboard.” He’d barely gotten the words out when he had to suppress an internal wince of chagrin—obviously, that hadn’t happened—and braced himself for a caustic observation on Delacourt’s own survival.
“No.” Her voice went chillingly flat, and her eyes had the distant, unfocused look of someone miles and years away. Her words came haltingly. “Half the team went when the tail blew off. Something hit me—” the muscle jumped beneath her scarred cheek— “threw me free. The ruck tangled. I got loose, and—” her jaw clenched. “Must have fallen right into an airburst. Don’t remember how I got to ground level, but...” A few breaths, mechanically-calm. “Wasn’t much left.” She scrubbed her hand over her face. “He found me. Sadistic fuck. Thought he’d play some games.”
Compassion warred with suspicion, but Adam recognized the signs of someone recounting the events that had broken them, and compassion won. “And you tried to take him out?” he asked, more gently, encouraging rather than accusing.
“I was dead already,” Delacourt said tonelessly. “My body just hadn’t realized it yet. Figured if I was on my way to hell, he could hold the door.” She shook her head, slowly, and her words fell like a guilty verdict. “Wasn’t enough of me left to do it right.”
“How the hell did you survive?” he muttered. It was a rhetorical question. She answered it anyway.
“He threatened to send me back to the Americans in pieces.” She paused; shadows slanted across the profile of her face, hiding everything but the faint glow of one eye—and the slow upturn of one replacement hand. “Guess he followed through.”
There wasn’t much he could say to that. She was telling the truth; of that he was absolutely certain. Her account had been too—jagged. He blew out a harsh breath, feeling guilty. In his drive for answers, he’d just dragged her through a still-bleeding trauma.
Adam wondered why she’d let him do it—then it hit him. He, of all people, ought to recognize an obsession when it stared him in the face. “Hell,” he muttered. By all rights, he should put her on a train back to Prague. But he wouldn’t. Leaving aside the small detail that she wouldn’t go, and he wasn’t sure he could force her—he knew how far grief and the burning need for vengeance could drive a person. He’d been there himself; he wasn’t that much of a hypocrite. Besides, it made her more reliable, not less. So long as their motives were aligned, Delacourt would play ball.
Doesn’t mean you have to be an asshole about it. He rubbed his face, fingers lingering on his own scars to soothe the phantom ache. “Ms. Delacourt—” Delacourt’s eyes snapped up to meet his. Her face was all but expressionless, the emotions of the last several minutes erased as if they had never existed.
“We have a job to do, Agent,” she said evenly. “The clock is ticking.” She walked past him, head held high, jaw set stubbornly, her outward calm broken only by a slight stiffness in the shoulders. He couldn’t help but wonder what it had cost her to pick herself up and keep going—an instant of empathy that, for a single moment, drove back the darkness in his mind. He had time, barely, to realize that something was very wrong… and although the black light of his dreams rose up to drown that realization before he could become fully aware of it, that understanding buried itself in the hidden places of his thoughts where even the unlight couldn’t reach.
Adam shook his head. The fleeting thought disintegrated beyond recall; he had better things to worry about. Delacourt was right: they had a job to do.
Chapter 11: Racing Toward the End of Days, Part I
Summary:
The intrusion's a cakewalk; what can go wrong?
Only everything.
Chapter Text
KYIV: MAY 2029
Sloane stared into the quiet darkness of the museum. Behind her, Jensen was carefully hacking the door that, if their intel was correct, would lead into the KGB satellite office. The plan from there was straightforward: raid the office for whatever information they could get and use the KGB’s own systems to forge permits to get them into the Chernobyl Nuclear Power Plant.
Simple. Straightforward. Just how she liked it.
Except… the intelligence was stale, and therefore unreliable. Anything could have changed in the last two years. She preferred fresh data—well, didn’t everyone?—but she had long experience adjusting plans to compensate for unreliable intelligence.
Except… that the man she was working with didn’t trust her, and she couldn’t rely on him to have her back. It was an unpalatable choice: her own safety, or that of the mission—and that meant it wasn’t a choice at all. She’d take the hit, if it came to it.
She took a deep breath and exhaled slowly, letting her annoyance dissipate; it was never a good idea to go into a mission angry. The click of a lock disengaging broke through her thoughts. “Got it,” Jensen murmured, a note of unhappiness in his voice.
“Problem?” She settled into her usual calm, turning her back on the silence of the museum. The door looked innocuous enough, but...
“Too easy,” Jensen responded. “I did a double-check to make sure I hadn’t missed any alarms or tell-tales, but…” he shrugged.
Sloane lifted a shoulder in response. “It is what it is,” she said philosophically. She drew her Zap and took a position to cover the door. “Ready.”
Jensen’s shade-covered eyes remained on her for a moment longer, then he flattened himself against the wall and opened the door. It was nothing more ominous than a janitorial closet; a second door was set in the far end. “Nice camouflage,” was his only comment. She waved him in ahead of her; his urban intrusion experience eclipsed hers, so she’d ceded point to him. He paused at the second door, head swiveling from side to side, then opened it to reveal a long corridor. “Thought you said this was a small office.”
It needled her, as she was sure it had been intended to; she unclenched her jaw and reminded herself again not to let him get to her. She counted to three, then said, calmly, “I also said it was two-year-old intel. With no way to get it updated.” He grunted what she thought was acknowledgment and moved quietly into the hall.
The dim light gave the industrial grey of the hall a faintly dingy look, but there was something subtly off about it. After another few steps, Sloane realized that the building lacked a sense of habitation, the weight of people coming and going and leaving their mark. She dropped to a knee—the carpet was clean, with none of the crushed fibers and ground-in dirt from passing feet. She rose to her feet abruptly, recognizing the source of her unease. The faint, sweetly acrid scent of volatiles in the air was a sign of freshly-dried paint. Probably the result of remodeling, it was innocuous in itself, but for them, it meant trouble.
“Jensen,” she said quietly, “This is all new. Fresh carpet, fresh paint—” Both their heads snapped toward the end of the hall at the sound of voices. Neither of them hesitated; Jensen vanished into the nearest doorway and Sloane darted in after. He flattened himself against the wall behind the door, and she slid across the top of an empty desk to crouch behind it. She flipped into enhanced vision to do a quick scan of the area; the source of the voices were two men, well-built, carrying sidearms, coming down the corridor on what was obviously a patrol route. “Two,” she subvocalized. “Armed. Patrolling.”
The voices grew louder, speaking not Ukrainian, but Russian. «—the fuck are we bothering with this? No one’s supposed to know we’re here.»
There was a coarse laugh. «When you become the Major, you can decide who patrols and who doesn’t. Until then,» the door slammed open, «make sure none of those fucking bums snuck in here to sleep.» A flashlight shone into the room, sweeping around briefly, managing to entirely miss both of them, and the door slammed shut.
“Fucking KGB,” she muttered. “Where there’s one patrol, there’s more.” She moved cautiously over to the door. “This changes the parameters of the mission. Do we keep going, or retreat and try to find another way?”
Jensen’s brow furrowed behind his shields. “If we can find a computer, I can get into their network, find what we need.”
“We’ll probably have to go down a level or two,” she said thoughtfully. “They’ve remodeled, so I doubt there’s any live computers on this floor.” He made a little noise of acknowledgment. “If you’re up for it, I vote we push on.”
“Let’s go, then.” He slipped out the door. She followed, keeping tight to the walls, scanning every room as they passed. They made it to the elevator, dodging patrols twice. Sloane looked around, frowning; she didn’t like elevators for covert work, but there were too many patrols near the stairwells. “There.” Jensen used his chin to point to a grate at floor level, several feet away. She gave him a skeptical look. “Trust me,” he said, as he opened the grate. She mentally rolled her eyes and followed him into it.
How the hell does he fit himself into one of these? she thought, as she crawled through the vent after him. Jensen paused at what she thought was a dead-end; he looked over his shoulder at her, raised one eyebrow, and pointed down. Seriously? she mouthed; he gave a slight shrug, shifted his weight, and let himself drop. She heard a faint thump at the bottom; it sounded like it wasn’t enough of a fall to trigger the Icarus. Sloane was just as happy about that; she shuddered to think of being in the middle of all that electricity when surrounded by metal.
She braced against the sides of the vertical vent and palm-climbed her way down. She slipped once, sliding down several feet with a sound like a pencil on a chalkboard; her HUD gave off thermal warnings and a faint scent of hot charcoal wreathed around her before the friction slowed her down. By the time she landed lightly at the bottom of the shaft, Jensen was gone.
She cursed silently, spinning up her vision enhancements. Jensen was easily identifiable by his augmentations; she counted five—six—seven people also moving around. Two of them were armed; the rest were carrying around boxes and electronics. Moving day, she thought. Great. Jensen was just at the edge of her vision, bent over a computer; maybe he’d found a security hub. And—she silently swore again—one of those armed figures was approaching Jensen from behind.
Sloane slid out of the vent, calling up her cloak. Invisible, she walked between two men carrying boxes, then sidestepped into a doorway and let it drop before she spent too much bioenergy. Her hand wrapped around the Zap; all she had to do was step around the corner and fire. Combat-taut nerves made the crackle echo too loudly in her ears, but a quick scan confirmed that no one else had heard. She hurried forward, sliding the Zap back into its holster, and hefted the man into a fireman’s carry. Fortunately, it was just a few more steps to the door, and she slipped through it just as Jensen looked up. “What the—”
“You’re welcome,” she said sourly. “He was checking random doors. Didn’t figure you’d want him checking this one.” She ignored the annoyed scowl on his face as she put her unconscious burden down behind a desk, well-hidden from the door. It was the work of a moment to pat him down. He had a flash-bang and a smoke grenade, which she pocketed. “Nothing useful here,” she said. “What did you find?”
“I’ve cut the camera feeds between here and the basement stairwell. Found some emails.” He indicated a second computer in the corner. “The permitting office is being moved to the basement.”
“And we’re on the clock now,” she said grimly. “The minute this guy doesn’t check in, the alarm goes off. I give it ten, maybe fifteen minutes.”
“Seems a bit overkill,” Jensen observed.
“They're the KGB, Jensen,” Sloane replied drily, “Overkill’s in their job description.” She joined him at the security hub. “What are we looking at between here and there?” He silently pulled up the floorplans; her on-board software automatically incorporated it into her HUD’s map. “Okay,” she mused, “I think the biggest problem we’re going to have is the movers. The patrols are usually predictable, but there’s movers everywhere and there’s no telling where they’re going to be at any given time.”
He studied her for a brief moment. “How are you on biocells?”
She shrugged. “Three. I’m at 80% right now; no problems there.” She hesitated a moment. “You?”
She couldn’t read the look he gave her behind his eyeshields. “89%, four cells.”
She thought for a few moments, gauging their resources, then nodded crisply. “No need to waste time on finding alternate routes, then. Let’s just cloak through the main corridor—here—to the stairwell,” she said.
“Right.” With that, he slipped out the door, and she followed. They made it undetected to the main corridor through the judicious use of recessed doorways. Jensen went first, stepping out and dissolving into nothingness; only the faintest hint of distortion in the air gave his position away. She couldn’t hear his footsteps—it took a lot of training for such a large man to be that light-footed. She didn’t think he was relying on augs for it.
Sloane followed suit and stepped carefully out into the corridor, keeping a watchful eye on her energy levels. It wasn’t too difficult for her to edge between the movers, but up ahead, Jensen was in trouble. He was stuck behind someone pushing an overloaded cart down the middle of the corridor. It was too wide to easily dodge, and too slow just to wait on; no matter what he did, he risked discovery.
Time for a distraction. Sloane singled out a man carrying a precarious armful of files, jostling the pile as she passed. The man yelped; the files scattered all over the floor, and she danced away with an invisible smile. Several of the movers set down their own burdens to help their hapless comrade, including the man with the cart. With everyone’s eyes on the commotion behind them, Jensen was able to squeeze past, while she vaulted easily over it. Together, they slipped into the stairwell and dropped their cloaks.
The stairs were echoingly empty.
The windows into the basement were dark. They exchanged wary glances—with everything else going sideways, Sloane wasn’t about to hope their luck had turned. This time she took the lead; Jensen fell back a step to give her room. She shouldered through the basement door, Zap in an easy, double-handed grip, and stepped half a century back in time.
Light flowed in from the stairwell, stretching her shadow out before her. The air was musty with the scents of long-undisturbed paper dust and crumbling concrete, with a soupçon of rusted metal to finish it all off. Ancient three-drawer file cabinets lined the walls, which hadn’t been painted—or even cleaned—since the fall of the Soviet Union. Above the cabinets were faded posters of the New Soviet Man looking improbably heroic, staring toward the stars in forlorn hope; here and there a hint of dull mint showed through the grime where the frames had shifted. Industrial tanker desks marched down the middle of the room in precise formation, looking oddly naked without their matching chairs. It was simultaneously echoing and claustrophobic; there was no way anyone in the room could have missed her entrance.
Just as there was no way she could miss the man in the KGB uniform at the far end of the room, bent over a genuine 90s-era desktop with its guts spilled over a desk. He looked up and spat a startled oath in Russian as behind her, Jensen snapped, “Shit. That’s the computer.”
«Drop it. Now.» Sloane trained her weapon on the KGB agent. He didn’t seem impressed; the Zap was less than menacing at the best of times. She circled around the desks, trying to get into range; Jensen took the opposite side. The Russian straightened up, stepped back, and produced a thermite grenade. The lever clattered to the floor; he tossed it toward the desk with a vicious grin.
Memory crashed down on her—the dull yellow of nicotine-stained teeth broken here and there by the blood-red typical of cheap Russian dentistry had been among Lermontov’s men; he’d been both vocal and pathetically unoriginal in his taunts—it was the smile that brought it back. A volcanic rage erupted inside her, and she felt her lips draw back in a snarl.
He was in motion even as her finger stroked the trigger. It was enough to make her miss; the capacitor dart shot past him, but before he could draw his own sidearm, the dart slammed into the grenade, sending electricity arcing into the air and shattering the outer casing. Molten thermite splattered everywhere—the desk, the floor, the computer, and the Russian. The air filled with the mingled scents of charred meat and scorched plastic.
He let out a high-pitched sound of agony, and even through her rage, Sloane felt a twinge of compassion. Thermite had burrowed into his face, leaving it half-carbonized, half-melted, exposing the mandible and the hollow darkness of his mouth. Liquid plastic—the remnant of a discreet earpiece—ran down his neck. His uniform ignited in half a dozen places where thermite hit, and stuck, and burned. He ran; fire ran with him.
Smoke poured from the desk where the majority of the thermite had hit; a fleeting glance made it clear that the computer was toast. As the wood veneer burned away, the smoke took on a new, more acrid note. Sloane whirled to run. “Move!” she growled over the infolink.
Jensen followed suit. “What?”
“Aluminum.” She coughed, missing a step; Jensen grabbed her wrist and dragged her along until she recovered. They were about five steps from the door when the sprinklers went off. Water hit the potent thermite-fueled aluminum fire and flashed into steam, boiling up, filling the room between one breath and the next. The fire alarms screamed, drowning out any other sound. Sloane’s skin tightened with the heat. Her Sentinel flickered a warning just before her rebreather kicked in, stealing her breath for a second. Not even thermals were getting through the dense white fog; she wasn’t sure who dragged whom out the door.
She staggered against the wall, panting as the rebreather let up. Jensen pushed himself upright at the same time she did. “What now?” crackled through the link.
“It’s blown,” she said. “Exfil, then decide on plan B.”
He gave a curt nod, and the alarms abruptly cut out. His muttered, “Shit,” seemed abnormally loud in the ringing silence. Boots clattered on the stairs, the echoes carrying just enough warning for them to act.
Sloane’s hand closed around the flash-bang. “Grenade out,” she murmured into the infolink, and tossed it up the stairs, bouncing it off the landing wall. She counted down two seconds, averted her eyes—BANG!!! Jensen hadn’t turned his head—dammit, she’d forgotten her flash protection—and surged up the steps. She followed, shifting right as he moved left, and they slammed into the disorganized patrol like a hammer.
Jensen threw a brutal body blow into the first guy’s gut, following it up with a pistoned elbow to the back of the neck. Sloane bounced off the wall, slammed her knee into another’s solar plexus, and snapped off a shot with the Zap at a third. Jensen cleared out the next two through the simple expedient of pounding one against the wall, then using him as a bludgeon to hit the second. Sloane charged through the gap; with a sharp kick to the knee and a rabbit-punch to the kidney, she put the last one down. Movement flickered in the corner of her eye; behind them, the first one Jensen hit had a pistol trained on Jensen’s back. Sloane reacted without thought. Her left hand flickered, and suddenly the would-be back-shooter had six inches of steel protruding from his shoulder. He screamed; Jensen looked back, then scowled at Sloane. “I should have let him shoot you?” she asked mildly, following the knife with a stun-shot. She slid the Zap back into its holster and moved cautiously to the top of the stairs; an annoyed grunt was his only response.
The hallway was clear; the only sign of the movers was the boxes they’d dropped in their haste to get out. About ten feet along, a smoldering body lay face-down on the cheap linoleum. Sloane knelt next to it, turned it over carefully, and winced; the thermite had burned away a good chunk of his head. “Shit,” Jensen muttered. “You happy?”
She started checking the pockets of his uniform, not looking up at Jensen. “I’m not sorry he’s dead, but I wasn’t trying to kill him. I’m not a monster.” Not yet, she thought. I hope. She paused. “He’s one of Lermontov’s Liquidators.”
“How do you know?” Jensen snapped.
“He was there.” That was all she could get out for a moment while the anger coiled up and wrapped around her throat. Jensen still looked skeptical; she snapped her head up with a glare, and whatever he saw in her face made him rock back a little. “Or do you want details?” The last word came out in a snarl, and Jensen actually took a step back, holding his hands up and shaking his head. She turned her attention back to the body, struggling to bring herself back control. Her searching fingers found one of the things she’d been looking for. Wordlessly, she turned the uniform’s lapel back to display a small pin as additional proof. It was the same as the seal on the Neuropozyne; a stylized drop of blood overlaid by alpha, beta, and gamma particle traces.
Her search revealed six hundred fifty credits on three chips, a billfold tucked into a chest pocket, a security keycard, an RFID key-fob embossed with a stylized АБ, and—she stopped at the hip holster, drawing out a pistol that looked like something out of a science fiction movie. The frame was all curves, from the smoothly rounded ergonomic grip to the smoothed-off corners of the slide. She held it up for Jensen to see. “The new Aspid. Only the best for Lermontov’s boys.” Automatically, she popped the magazine and cleared the chamber; the action was smooth, and an experimental dry-fire revealed a comfortable trigger pull. It was a moment’s work to swap her no-name 10mm for the Aspid. She glanced up to see Jensen’s eyebrow raise sardonically—but not, she thought, disapprovingly.
“At least we know we’re on the right trail,” Jensen rumbled. She rose to her feet, raising her own eyebrow inquiringly. He jerked his chin at the body. “Lermontov wouldn’t be trying so hard to cover his tracks if there wasn’t anything to hide. He must not have expected anyone to be so close behind him.”
“Well,” Sloane checked the ID in the billfold, “Yevgeny Vasilevich Nikolaev won’t be carrying any tales back. We still have a chance.” She turned as lights flashed in the front windows. “Gotta get out of here first, though. Company’s coming.” Experimentally, she pressed the locator button on the key-fob; the light on the edge pointed toward the back of the building. She tossed it to Jensen, who caught it with a surprised look. “There’s a bike out the back. Take it and go; I’ll catch up.”
“You can’t—” he started to protest.
“I fucking can,” she snapped back. “I know this city. You don’t. I’ll tie them up long enough to give you a head start.” She looked up; there was an open vent right above her. It gave her an idea. “Go. I have your IFF.”
Jensen’s lips thinned angrily, but he turned and strode down the corridor without another word. Sloane felt faintly relieved; now she only had her own back to watch. She took two steps up the wall and leapt, catching the edge of the vent and pulling herself up just before the front doors slammed open. She went up the vent in a sort of vertical crawl, just like free-climbing a narrow rock chimney. Halfway up, she heard hard feet and angry voices behind her. She grinned, wiggled her arm to her belt, and twisted her wrist around at a positively unnatural angle to retrieve the second of the grenades she’d acquired upstairs. She let it fall, and continued her climb. Below her, angry voices erupted into a confused babble.
The vent turned horizontal at the third floor. She eeled herself along until she found a vent and slithered out into an empty corridor. She headed toward the back of the building, only to pull herself up short at an unexpected dead-end—that hadn’t been on the building floorplan. “Fuck,” she muttered. Going out the back was no longer an option, and she couldn’t waste time looking for a way around.
Tant pis. She was sure she’d done stupider things than jump into a trigger-happy patrol of KGB agents, but she couldn’t remember them just now. A smile curved her lips; adrenaline pumped through her veins and sizzled along electronic nerves. Stupid or not, this was the kind of situation she lived for.
Sloane headed toward the front of the building at a jog. Before she reached the last stairwell, its door slammed open and disgorged several armed and angry KGB agents. One spotted her before she could cloak; he shouted and swung his pistol toward her. She launched into a dead run, pounding toward them with a wild yell. It shook them enough so that their bullets went wild; she angled right and took one—two—three steps along the wall, landing lightly behind them. Her radar lashed out, probing the big windows in front; all the weak spots where the frames hadn’t been reinforced to hold the new, heavier bullet-resistant glass popped up on her HUD. Without checking her stride, she launched herself at the nearest, curling into a ball and taking the impact on her augmented shoulder.
She hurtled outward in a fountain of broken glass, bullets screaming past her. Agents below her shouted and tried to bring weapons to bear; a lucky shot smashed into her back and punched through the armored leather jacket. Her Sentinel flashed warnings, but she was abruptly too busy to pay attention to them. The HUD flashed yellow—the Icarus took control—and a cannonball of crackling electricity slammed into the pavement hard enough to shatter concrete and fling people back like dolls.
Sloane picked herself up, giving the area a quick assessment. Neatly parked at the far end of the narrow lot were several big Buran motorcycles—over-engineered monstrosities with oversized power plants and enough computer support that they could practically drive themselves. Much more convenient was a late-model Cavalieri racing bike: sleek and aerodynamic, its every line screamed ‘predator’. The spokeless wheels, undoubtedly made of some variable-friction carbon nanomaterial, still looked like old-fashioned rubber. A helmet was slung between the handlebars, and, best of all, the keyfob was still in the hand of an unconscious KGB agent just a few feet away. She snatched it out of his hand without pausing, and thumbed it alive.
The bike’s power plant brightened to a cherry red and a soft glow radiated from the helmet. She slid onto the bike and slung it on; its onboard HUD displayed only ДОСТУП ЗАПРЕЩЕН. «User not recognized,» came an emotionless voice. «Unauthorized use of this vehicle is punishable under Article 158 of the Russian Criminal Code.»
Around her, people on the edge of the shockwave were starting to pick themselves up. Hurriedly, she pulled out a multi-tool and aimed it at the bike. Time was, all you needed to steal a motorcycle was a fucking screwdriver. She checked her HUD—the shoulder wound was sealed off, the cracked bone mending. Good enough. The multi-tool beeped; the error message cleared. In its place was a 360-degree panorama with informational overlay. She fed the bike some power and grinned as it responded with a growling roar. Electric it might be, but somebody had designed it to sound like a proper bike.
Sloane tore out of the parking lot; behind her, a high-pitched whine warned of the pursuit to come. “Fuck, don’t these assholes give up?” she growled. She pulled up one of her personal playlists and fed it through the bike, and soon she was being cheered on by Springsteen’s trademark rasp covering an AC/DC classic. “Fine. Let’s dance.”
She turned northeast, toward the river. South was absolutely out; she didn’t want to lead this kind of trouble into the tourist and historical areas, nor did she want to get caught in the governmental center. Jensen’s transponder flickered unsteadily on her HUD. “Alpha Juliet, Sierra Delta, respond, over,” she muttered via infolink. Something crackled, but she wasn’t sure if it had been Jensen or just interference. “Juliet, Delta, last transmission was broken. Repeat, over.”
Still nothing.
Sloane scowled. Infolink transmissions were as susceptible as any other microwave transceiver to being jammed, assuming someone was willing to degrade local cellular and wifi services as well. They’re the KGB. Of course they’re willing. “Juliet, Delta,” she tried again. “If you’re receiving, the party got a little hot, but I’m on the move and attempting to link back up with you. Delta out.”
Her HUD was suddenly full of sensor ghosts, randomly fading in and out. Though the helmet’s visuals weren’t picking anything up, she could feel the itch at the back of her neck that always warned her of impending trouble. On a hunch, she shifted to thermal and finally spotted the hazy outlines of six other bikes coming up to bracket her. She let out a pungent curse in Russian—those bulky power plants powered a thermoptic cloak!—and they’d almost managed to get the drop on her. Her lips drew back in a fierce grin; after the stresses of the last few days, it was almost a relief to give herself over to some justified violence.
She cut sharply right; her cybernetics tingled as she broke through the cloaking field. Mere inches from her leg, her target dissolved into visibility. He pulled a pistol, firing across his body, but she’d already tapped the brakes just enough to throw his aim off. Bullets whizzed in front of her visor and spanged against another bike coming up hard on her left. They were all shimmering into existence now, eerily quiet against the roar of her bike.
Sloane ducked a shock-stick from the left and goosed the throttle, matching speeds with the first bike. He took aim at her again, extending his arm just a little too far; she gave his wrist a vicious twist. Bone snapped; the pistol fell from his hand, and a vicious shove sent his bike out of control. On her left, the guy with the shock-stick brought it down again; she grabbed it, yanked it out of his hand, and smashed it into his faceplate. Electricity arced and snapped, and the rider’s hands spasmed closed on brake and throttle alike. His bike went ass over teakettle in an uncontrolled somersault, taking him with it in a tangle of metal. A second bike slammed into the wreck, flinging its rider into the unforgiving asphalt.
Another on the right, swinging his shock-stick; she blocked it, then stabbed down hard to smash through the shielding on his power plant. The resulting surge of power propelled the KGB bike forward uncontrollably—it was still accelerating when it impacted a retaining wall. Without slowing, Sloane abruptly slewed right into a construction area, watching her last two pursuers flash past her. She hurtled over the uneven ground, barely on edge of control.
She pulled back onto the road a couple blocks away from a subway station, killed her emissions—lights, engine noise, onboard radar—cut power to minimal, and covered the short distance like a ghost. The subway was shut down for the night, but that didn’t bother her; she wasn’t planning to take a train. The Cavalieri handled the stairs down with panache. She jumped the bike down onto the rails, letting the darkness of the tunnel swallow her, any electronic signs of her presence obscured by tons of concrete, metal, and earth.
Sloane surfaced not far from where she’d last pinged Jensen’s IFF. With a sense of relief, she saw his icon appear; he was headed her way, just making the turn onto the Havansky Bridge. Relief, however, was short-lived: a cloud of sensor ghosts started popping in and out halfway down the bridge. “Jensen!” she snapped into the infolink. “Turn back!” Her words disappeared into static. She pulled out her backup NVGs and slapped them to her face, turning up the magnification, just in time to see Jensen smash into thin air. His body curled in on itself as it rolled over the SUV—now dissolving into visibility—and landed on the concrete in a little puff of road dust.
“Fuck!” she growled, throwing her bike back into motion, hoping she’d get there in time…
Chapter 12: Racing Toward the End of Days, Part II
Summary:
After a hair-raising escape from the KGB, Adam comes to some unwelcome realizations, while in the wake of their failed infiltration, he and Sloane need to come up with a plan B...
Notes:
(See the end of the chapter for notes.)
Chapter Text
KYIV: MAY 2029
Adam sprawled on the pavement in a daze and tried to breathe. Distantly, he wondered what had hit him, but figuring that out took second place to getting his stunned lungs to start up again. Just as his vision started to narrow around the edges, the rebreather kicked in; it didn’t make his chest feel any better, but at least he wasn’t suffocating. His HUD was tinged a lurid red—half his systems were resetting from the impact. It was definitely worse than being blown up and thrown into a cargo container. (Not for the first time, he was appalled at his ability to make such a precise comparison.)
He tried to drag his wits back together. Words floated in the air around him—Ukrainian, Russian, he wasn’t sure which, and his onboard translator wasn’t helping. Suddenly, it didn’t matter; a shortish woman with a cruel set to her eyes stepped over to him and aimed a pistol at his face. The scene wavered, and for a moment he was back at SI, staring down the barrel of his own revolver, white-tendoned finger closing on the trigger—
The world shattered in a roar and a flare of light, but the expected bloom of agony didn’t follow. He blinked—all around him, people had thrown their hands up to protect their eyes, while an amorphous monster bore down upon him. The image resolved itself into a motorcycle and rider, rocketing toward him at a breakneck pace. It showed no signs of stopping, and still—still—he couldn’t get his body to move! He flinched back in anticipation of the impact, only to hear the squeal of an abused tire skidding to a halt mere inches from him. Momentum hurled the back end of the bike into the air, but it didn’t flip; with a tremendous twist of their hips, the rider flung it into a sideways spin. It smashed into the woman with the pistol, sending her flying. The still-turning rear wheel hit a second ambusher, shredding his vest and throwing him into the SUV behind him, and the bike landed neatly next to Adam’s prone form. Somehow, the rider had pulled a pistol, firing like a metronome one-two-three. His abused ears registered the sound of a Zap, just as the last ambusher fell in a limp heap.
The visor smoothly rose to reveal the grinning face of Sloane Delacourt. “Need a lift?” she inquired cheerfully, extending a hand down to him.
Adam found he could move again. He reached up and let her pull him to his feet; the faint sizzle as their hands touched barely registered amidst the rest of his body’s complaints. “What kept you?” His voice came out a little more gravelly than usual.
“Party got a little out of hand,” she chuckled. “They didn’t want me to leave.” She slid forward, making room for him on the bike. It was a tight fit; he was pressed closely enough to her that in any other context, she probably would have slapped him.
“What the hell hit me?” he grated, as she turned the bike neatly to head back the way he’d come.
She shifted to infolink. “That SUV. They’ve built cloaking systems into some of their vehicles.”
Adam’s inner gearhead was momentarily intrigued. “The engineering tradeoffs have to be a pain in the ass,” he murmured.
“The power outlay’s insane,” Delacourt agreed. “They can’t maintain it under any kind of serious maneuvering—” such as the nimble hairpin turn she executed onto a freeway— “Good for ambushes, though.”
“Yeah,” he muttered sourly.
“Sorry,” she actually sounded contrite. “I tried to warn you, but they were jamming comms. It took me a bit to get ’em off my tail. Hopefully we’ve shaken them for good.”
Icons flickered onto the edge of his radar, coming up behind them. “No such luck. Check your six,” he advised. More icons popped up ahead of them, rendered irrelevant by the sudden appearance of bright red and blue flashers forming a barrier across the bridge. “Blockade!”
“Putain!” Delacourt snarled. “Hang on!” With no other warning, she spun the bike in a smoking 180 (barely avoiding a rattletrap Kulibin older than he was), opened up the throttle, and hurtled back toward their pursuers. He ducked down behind the screen of her body and hung on grimly as she wove through the oncoming traffic with a dexterity that made him suspect she was pushing her reflex boosters to their limit.
The highway cleared as law-abiding drivers scattered to either side in front of the oncoming lights and sirens. She lined them up on a KGB car—the distance between them was closing fast—and for a heart-pounding second, he wondered if she was playing a game of chicken. At the last second, she slewed sharply to the left and bounced up the on-ramp, still going the wrong way. Behind him, the squeal of tires and the slam of metal into metal suggested she’d taken them by as much surprise as she had him.
Delacourt took another hard left onto a narrow street that hadn’t seen regular maintenance in years. The ground dropped sharply off on the left, and a graffiti-covered brick wall hemmed them in on the right. She slowed for a moment, helmeted head swiveling smoothly back and forth. The sirens behind them grew louder. “I hope you have a plan,” Adam growled.
“Yeah,” came her annoyed-sounding reply. “Go where they can’t. You might wanna duck…” She cranked up the throttle again, heading directly for some half-collapsed scaffolding against the wall.
“Shit! A little warning!” Adam ducked as the motorcycle bumped up the makeshift ramp, and the metal cross-beam merely ruffled his hair instead of taking off his head.
“Going airborne!” She flung them up and over the top of the wall, still in motion when they landed. The confluence of train tracks suggested they’d ended up in a switching station for the Kyiv metro, and the bike spat gravel behind them as Delacourt sped down one of the tracks.
In his shock, Adam completely forgot to subvocalize. “Are you crazy?!” The irregular ruts of the road were replaced by the more rhythmic bumps of the cross-ties. It had the advantage of forcing her to slow down.
“Track’s down for maintenance! We can use the metro bridge to cross the river and lose ourselves on the other side!” She looked back at him briefly, but all he saw was his reflection in the helmet’s featureless visor. “Sound good?”
It… wasn’t a half-bad plan, and no time to debate it anyway. “Do it!” he shouted. In response, the bike leapt forward. The distance between them and the river melted away, and the ground beneath them was replaced by the darkness of water. He started to breathe a sigh of relief; then he looked up and saw lights where no lights should be.
The lights were getting bigger.
“Train!” he managed to grate out.
“What?” came Delacourt’s startled response.
“TRAIN!” There wasn’t room or time for her to turn the bike around, and the steel girders on either side made it impossible for them to ditch. Adam braced himself for the inevitable impact.
Delacourt’s voice over the infolink was strangely calm, almost conversational. “Hold tight. And hit your Icarus when I do.” Adam tightened his grip as she somehow coaxed more speed out of the motorcycle. He was pressed so closely against her back that he swore he could feel her reflex boosters engage, the hot flush of adrenaline spreading up and out from her kidneys, though he knew the layers of armored leather between them made it impossible. She held the bike steady, one-handed, as the train bore down on them and the bridge supports blinked past in white streaks, and then, suddenly, there was only dark to either side. Her free hand flashed blue, the bike cut left, and they were soaring through a hole in the guardrail while the train roared past less than an inch to their right.
A bare second later, Delacourt’s Icarus flared to life. Adam followed suit, hoping it would slow them down before they ran out of air. 3… 2… 1— They hit hard, but on a scale of one to smacked-across-a-runway-by-a-cargo-pod, it came to about a three. Even the bike mostly survived; the engine sputtered and the rear wheel felt oddly wobbly, but Delacourt was able to nurse it well away from the train tracks, finally coming to a halt in what looked like it had once been a picnic area, and now was mostly trees and overgrowth.
They dismounted almost in the same motion, and Adam felt surprisingly bereft as the cool night’s breeze replaced the warmth of Delacourt’s body. She pulled her helmet off and, in a voice midway between a laugh and a growl, exulted, “Goddamn that was a hell of a ride!” He couldn’t look away from her there, laughing and vital, only the frail barrier of the bike separating them, and for the first time in years he felt himself staggered by a tsunami of desire. He wanted her. Wanted her to look like that for him, wanted to watch her ferocity melt into satiation under his hands and his tongue and his—
Fuck. He forced himself to turn away. Not here, not now, not her— It was the same attraction he’d dismissed after running Kyiv’s rooftops—and it was a risk he couldn’t take. She still had that familial connection to the Illuminati—even if she wasn’t his enemy, she could be used against him. Even if that weren’t the case, they had a mission, dammit! He couldn’t let this happen. Absolutely did not need to think about how well their bodies had fit together there on the bike. Or the scent of her as he’d breathed against her neck.
Fuck. He fumbled for a cigarette, tried to drown out her scent in the familiar acridity. Tried to use the ritual to control the unexpected—unwanted, came the sharp little prod from the back of his mind—sensation. It took three cigarettes before he was able to shove it into the mental closet where he kept all the things he didn’t want to think about. (Followed immediately by the thought that that mental closet was getting pretty damn full.)
Adam paced back around to find Delacourt leaning against the bike, fumbling with an arm panel. His flush of relief that she’d failed to notice his momentary loss of higher reasoning functions was short-lived. Now that her survival-fueled hilarity was past, her face was drawn and pinched; her posture spoke more of exhaustion than ease. He belatedly remembered that she’d drawn heavily on her augs without the opportunity to recharge.
Dry leaves crunched beneath his boots; her head snapped up at the sound, wariness in her eyes. He paused, just within arms’ reach, and offered her a spare biocell. “Looks like you need it.”
She took it gingerly, fingers never touching his. “Thanks,” she said quietly. “Thought I had one last one, but…” Her left shoulder lifted in a shrug, and a wince crossed her face. “Murphy was working overtime tonight.”
Adam hadn’t missed the wince. “You hurt?”
She was just a little too obviously focused on inserting the biocell. “Nothing that would slow me down.” It wasn’t a ‘no’, but she wasn’t inviting further inquiries. The biocell snapped into place, her arm folded itself closed, and she straightened up, the animation draining back into her face. “We need to move. They’ll get here eventually, and we should be long gone when they do.”
“We’re on an island,” he observed drily. “You have a plan for getting us off?”
Delacourt huffed quietly. “As it happens, yes. We’re in Muromets Park, smack in the middle of the river junction. The interior’s left wild for backpackers, but there’s a couple marinas where we can appropriate a boat and make our discreet way to the left bank. From there, we can hoof it back to the safehouse. It’s only a few miles.”
Adam supposed he ought to feel worse about the prospect of committing Grand Theft Vehicle twice in one night, but it wasn’t like they had many other options. “And the bike?”
She shrugged. “It’s a damned shame, but leave it. Even if they track us this far, there’s no way for them to tell where we’ve gone.” Adam turned this over in his mind, and decided she was probably right. “Mind you,” she added, “when Nikolaev doesn’t report back, Lermontov will guess someone’s on to him. If we’re lucky, we’ve got a couple days window, but I’d rather not use more of it than we have to.” Delacourt ran a hand through her hair, then pushed herself to her feet. “Have to decide which backup plan we’re going with once we get back to the safehouse.”
“Right.” He followed her lead into a tangle of underbrush. Beyond the tangle turned out to be a narrow but well-trod trail. Aside from the faint crunch of their footsteps, the night was silent. Adam missed the comforting little city sounds he was used to. It made him uncomfortable enough—or maybe it was something else, something he refused to think about—that he cast about for something—anything—to say to break the silence. “So… ‘tracks down for maintenance’?”
His CASIE read the heat in her cheeks, though it didn’t reach her voice. “According to the city website, yes,” she replied drily. “It wasn’t scheduled. Wasn’t a passenger train, either. You didn’t happen to see any markings?”
“I was a little distracted at the time,” he said.
He could see enough of her silhouette to catch the shrug. “Just curious. Might make sense of some rumors I kept coming across, back in the day.” Her next words were uncharacteristically hesitant, even uncertain. “Something called the ‘Black Train’.” It was one of the many shadowy rumors associated with his investigations into the Illuminati; he didn’t think it was a good idea to mention that, however, and simply made a noncommittal hum.
Delacourt took it as an invitation to continue. “Operator urban legend,” she explained, ducking beneath a low branch, then holding it out of the way for him. “You hear stories. Secret black ops groups that aren’t accountable to any government.” Adam’s breath caught in his throat—she couldn’t mean the Tyrants— “blacker-than-black rendition sites—hell, Rifleman Bank proved that one! FEMA detention camps.” She snorted. “As if FEMA could find its own ass with a map and a taclight.” He choked down a rebuttal; if she didn’t know, it was safer for all concerned to keep her as far out of it as possible. “But secret groups, secret bases, they need logistics, right? Hence,” she waved her hand in the air, “the Black Trains. They run in secret. Off-schedule, after dark, on lines that are officially shut down. Some say they’re prisons in their own right, some say they’re just there to move people, always keeping them in the shadows. Hell, I’ve heard a few people say they run underground.” The sound she made wasn’t a scoff, and it wasn’t amusement; it almost sounded… thoughtful.
“You don’t really believe all that, do you?” Adam tried his best to make it sound casual—like she wasn’t treading dangerously close to secrets that people would kill over. Or as if he was trying to probe the extent of her actual knowledge. From the sharp glance she sent his way, he wasn’t certain he’d succeeded.
“I think—” she said, as the woods peeled open before them. Gravel crunched beneath their boots, and the only mar on the city-lit face of the Dnieper was the dark bulk of the marina that was their destination. “I think,” she said like an extinguished fire, “it doesn’t matter what I believe.” She swept a hand to indicate the boats bobbing serenely at anchor. “If you would?”
There was no recovering the conversation after that; they returned to the safehouse in silence.
Adam came into the living room after a quick shower and change of clothes. Delacourt had gotten there before him; she was already going over the various backup plans, if the images on the wall TV were anything to go by. Her hair was still damp, a half-eaten energy bar within easy reach. Despite that, she looked tired, her face furrowed in a ferocious scowl. He made a little scuff with his foot to announce his presence; her head snapped up, her expression smoothing into a wary politeness. He felt a vague sense of disquiet at the way she closed herself off, but it was no more substantial than a soap bubble, dissipating at the slightest mental touch. His fingers tapped a hard-edged object in his pocket, pulling him back to his original intent.
“Things were moving pretty fast out there,” he said awkwardly. “I, uh, didn’t get a chance to mention—I managed to grab something when we booked it out of the basement.” The OSD he pulled out of his pocket was battered, but the case was still intact. “Hopefully there’s something on there we can use.”
He shifted uncomfortably under her cool look, remembering the way he’d laid into her for hiding information. “It’s something,” she conceded after a long moment. “Worst case, we’re in the same position we were without it. Nice work,” she added quietly.
“Blind luck,” he shrugged. Remembering Pritchard’s rants—How many times do I have to tell people not to connect an unknown data source to the company network?—he hooked it up to the other laptop, the one currently offline. A quick scan revealed not a landmine, but a treasure trove. “Really blind luck,” he added. “This is an archive of architectural plans.” A cutaway side-view caught his eye. “Including a significant underground complex.”
“What?” Delacourt yelped. “That’s—” Her fingers rattled on her keyboard for a moment; she stared at whatever she’d found, then leaned back in her chair with a look of disbelief. “Who the hell would build an underground complex there? I’m no geologist, but phrases like ‘loose sediment’, ‘high water table’, and ‘leaky aquifers’ do not fill me with confidence.”
“Beats me,” Adam replied, a little mendaciously. It stank of the Illuminati—sparing no expense to hide something where no one would expect it—but he wasn’t sure, and that should let the fib pass unnoticed. “But if they built it, it extends all the way to Pripyat.” He clicked on a few documents, but the Cyrillic baffled him. “There’s a lot of documents in here I can’t read.”
“Let me see them,” she ordered; he was too relieved to actually have a direction to take umbrage at her tone, and simply passed them along. “Holy shit,” she breathed. “Work orders, construction invoices—huh, there’s a geological survey, and—” She actually snickered. “Oh, man. Reading Soviet-era reports is always fun, especially when they’re trying to inform their bosses that said bosses are being idiots without actually saying so.” She looked up at him with a wry smile on her face. “Apparently, phrases like ‘loose sediment’, ‘high water table’, and ‘leaky aquifers’ filled the geologists with even less confidence than they did me. Unfortunately, Mother Russia trumped Mother Nature, and—goddamn those are some big pumps.” She tilted her head, eyes calculating. “If my math is right, this complex alone takes up most of the output of one of the reactors.”
Adam looked at her. “There’s, what, three* reactors still running?”
“Two,” Delacourt said confidently. “Reactor two was shut down in the mid ’90s after a fire. The EU wanted to get the other two shut down, but Russia made it contingent on foreign aid to replace the sarcophagus and build two new reactors elsewhere to replace them.” she shrugged. “Negotiations bogged down in the early oughts.”
“So the underground complex could still be live,” he mused.
“If that’s where Lermontov is breeding his bioweapon, I’d lay odds it is,” she confirmed. She folded her arms across her chest, fingers tapping on the opposite forearm, a look of speculation on her face.
It surprised him how easy she was to read when she forgot to guard her feelings; it wasn’t so much transparency as a blunt sort of honesty. Or maybe she just didn’t give a damn. He was getting the sense that she was very much the ‘damn the torpedoes, full speed ahead’ type. Nor could he fault her intelligence or capability; she’d been as unpleasantly surprised by the events of the evening as he had, but she’d demonstrated she could adapt and react with the best of them.
She’d come to his rescue—and apologized for not getting there faster.
It was the sort of thing to inspire trust—not through words, but through actions—and he didn’t see any artifice there. Even his paranoia had to admit that if she’d wanted him dead, all she’d had to do was be a few seconds too late. Setting aside that stab of unwanted desire—was it? was it really? He was very carefully not thinking about that—he was beginning to believe that somehow, despite all the tangled connections in her past that suggested otherwise, she was just what she said she was. If that was the case, he could afford to cut her some slack. If not, whispered that intrusive little voice in the back of his mind, it left her enough rope to hang herself.
“That still doesn’t answer the question of how the hell we’re going to get in there,” Adam commented. “Unless you have an idea.”
Her eyes crinkled in sly amusement. “Well,” she offered, “we could always make a movie.” The corner of her lips turned up in a half-smile. “That one’s always a classic.”
Adam was about to make a heated response, when he remembered an old based-on-a-true-story movie he’d seen during his college days. “Sure,” he agreed instead, making sure his tone oozed affability. If she was going to yank his chain, he could yank right back. “Something post-apocalyptic, you think? Or maybe a giant monster movie.”
Delacourt’s look of wide-eyed astonishment was something to treasure—at least, for the all-too-brief moment before her smile widened into a wicked grin. “I love it! All right, so all we need are,” she started ticking them off on her fingers, “cameras, set designers, technical experts, really good fake IDs to support it all, and—oh, yeah—a script.” She snapped her fingers, mock-ruefully. “Drat. Well, there goes my dream of Hollywood super-stardom.”
“I guess,” he said drily, “that leaves us with plan C.”
Her smile faded. “I have a plan C,” she said, “and the intel you found about the underground complex makes it actually workable. It’s not without risk, but I think it’s the best option we have.” She took a deep breath. “How do you feel about a little camping trip?”
Notes:
I've taken some artistic liberties with the history of Chernobyl in the DX universe; the history of Russia and the former Soviet states is *also* different, and, well, there's the Illuminati to consider.
Additionally, the "movie" gag is actually a little bit of CIA history... Argo.
Chapter 13: Nuclear Infected
Summary:
An unexpected detour through the Red Forest almost ends in disaster...
Notes:
TW for dead bodies and violent wildlife encounters...
Chapter Text
CHERNOBYL EXCLUSION ZONE, MAY 2029
It was the second day of their hastily improvised wilderness vacation, and they’d had to circle far to the south of their intended route to avoid a nasty hotspot. The detour had already added a day to their travel time, and Sloane could only hope they didn’t have to go too much farther out of their way. She chanced a glance at Jensen, who was carefully watching where he put his feet. City boy learns fast, she thought wryly. Then again, once you knew how to move with stealth, it was just a matter of figuring out what to watch out for.
The forest here made her uneasy. For the hundredth time, she reminded herself that the Red Forest wasn’t normal. Once, it had been a mixed-growth forest, pines and birch intermingled, but conifers were more susceptible to radiation than deciduous trees. The pines had died within a year of the meltdown; the rust of their needles had given the area its name. The dead pines had been long since buried, and the forest was more birch than pine now, but the name remained.
It was the absence of birdsong, she decided. Another casualty of the meltdown; although a wide variety of animals had moved into the area after people moved out, the bird and insect populations had been badly affected, and even now were much lower than normal. The silence that in any other forest would have meant danger was simply a sad fact of life in this blighted place.
Damned if she could tell her gut that, when every instinct she had clamored that this was a place of death, and she had no business being here.
Sloane’s nerves were wound tightly enough that she actually jumped a little when Jensen’s voice crackled through her infolink. “Got something here. I think… you need to see this.”
She picked her way through the closely-grown birches to join Jensen; “this” was the wreck of a wood cabin, no more than five meters by five meters. The ground beneath the cabin had collapsed, taking half the building with it. Its one remaining wall leaned precariously, held mostly vertical only by a conveniently-placed tree. Splintered wood hung like teeth against the dark maw of the cavern, but—“Do you see that?” she asked, indicating an angle that was far too regular to be natural.
“Huh. Why would a forest shack have a cellar?” Jensen asked, logically.
“If it was built over a zemlyanka…” He frowned, clearly not recognizing the word. “Dug-out shelter, sometimes concrete-reinforced. Partisans used them to hide during World War II. This would have been a good place for one when Operation Barbarossa was in full swing.” Absently, she rubbed the back of her neck. “What the hell would anyone want out here, though?”
“Only one way to find out,” Jensen said. She shrugged agreement, and the two of them advanced carefully upon the ruin. The ground surrounding it was torn and trampled, and the Geiger counter at her wrist rattled angrily.
“Looks like something’s exposed the radioactive sediments,” Sloane warned. “We shouldn’t stay here more than an hour.”
Jensen’s eyebrows had a distinctly sardonic quirk. “If we’re here that long, we’re probably in bigger trouble than just a little radiation.” He broke off a length of wood, propping it under a particularly precarious-looking part of the ruin. While he did that, Sloane took a better look at the immediate area. She saw animal tracks galore—mostly deer, if she was reading them right—but what she didn’t see were human footprints.
“Right,” he said, having set a few more props while she was studying the ground. “That’s about as stable as it’s going to get.” He turned his head toward her. “How do you want to do this?”
“One of us should stay up top,” she responded immediately. “That way, if it collapses, we aren’t both trapped.” She chewed her lip in thought. “I’m a little smaller, so I should probably go.” She tried for a smile, but it felt odd on her face. “Good thing I’m not claustrophobic.”
“Makes sense,” Jensen said. “I’ll keep watch up here.”
Sloane slid out of her pack—it wasn’t large, but she wasn’t taking any chances—and hunted around until she found the stairs down. The concrete hadn’t crumbled, but the steps were short and shallow, slick with mud and half-rotted leaves. She placed her feet carefully with each step, making sure she was stable before taking the next. It took what seemed an eternity to reach the bottom, but the clock said it had only been about a minute. “Okay,” she murmured into the infolink, “I’m down.” The sun didn’t penetrate this far down. A chill ran through her—it must have been due to the cold. She rubbed her hands up and down her arms, then gave up the attempt to chase away the chill and pulled out her flashlight. “Fuck, it’s a mess down here.” It looked like part of the concrete ceiling of the zemlyanka had collapsed—in fact, that might have been what brought the whole thing down. She turned slowly, making sure that her eyes were set to ‘record’. “They were monitoring something down here. Lots of screens, all smashed to shit.” Something flashed white under her boot; she bent down and pulled a crumpled, torn piece of paper out of the muck, but it was totally illegible.
“Anything like an OSD down there?” Sloane didn’t want to admit it, but the sound of Jensen’s voice was reassuring. “They had to save the data somewhere.”
“If there was, it’s either buried in the muck or resting in pieces,” she replied tartly. “I’m not kidding when I say it’s all smashed; someone really did a number on this place.” She turned toward the half of the cellar with the collapsed roof. “I’m going to see if anything survived under the roof.”
“Try not to get yourself crushed,” Jensen advised, irony infusing his voice.
“Number one on my to-do list,” she replied, equally ironically, making her careful way through the bunker. “I think I can—fuck!” She shifted her weight backward, barely managing to avoid stepping on the pale, vaguely luminescent leg sticking out from beneath the wreckage.
“You okay?” Jensen actually sounded concerned.
“Yeah,” Sloane said. “Got a body here.” She pulled out a flashlight and crouched next to it. The faint glow was washed out by the brighter light; what she could see of the limb was covered in a grey, greasy-looking wax. “Fucking hell,” she muttered, “this thing’s saponified.” She leaned back on her heels and wracked her brain for anything related to—
“Saponified?” Jensen’s voice was simultaneously wary and curious.
“It’s a soap mummy. The body fat turns to soap. The conditions have to be right, but I can’t remember details other than the soil has to be pretty alkaline. You get soap when you combine fat and something alkaline, like lye.” Sloane realized she was babbling and snapped her mouth shut, annoyed that she was letting her nerves get the best of her. “He’s been here for a few months, at least. I don’t remember how long it takes for saponification to start, but it’s not that long.” She straightened up, took a step back, and played the beam around. “Got the stock of a weapon here—looks like a rifle.” She edged over, trying to find decent footing. The rifle was half-buried under concrete and wood, but it slid easily at even a tentative pull. “Ok, guy’s military or paramilitary. Got an AK-27 here.”
“So, Russian military,” Jensen said. “Have those even had time to hit the black market?”
“I wish,” Sloane grumbled. “I hate the FR-27. It’s not a combat rifle, it’s a PDW with delusions of grandeur.” Jensen made a noise that might have been a chuckle. She was tempted to claim it like she had the Aspid, but without ammo it would just be an awkward club. Instead, she turned her attention back to the corpse. From where she was, if she angled the beam just right, she could see—
She swallowed hard. “Cause of death is pretty obvious. Gross injury to the lower abdominal region, resulting in partial evisceration.” It was a clinical way of saying that his abdomen had been savagely ripped open enough for the guts to spill out. “Can’t determine if there’s thoracic involvement due to the wreckage.” The darkness pressed in on her; the flashlight was a frail defense. Her mask couldn’t block the dank and fetid stench of stale mold and rancid pork, all underlain by a heavy, musky odor she couldn’t identify. Her heart pounded in her chest, racing to the clack of the Geiger counter; she overrode it, but it was no help against the feeling of dread creeping up her spine. She spoke rapidly to try to cover her discomfort. “This is a bust; I can’t go any deeper. Coming out.”
“Copy that,” he said, as she suited deed to word, climbing out of the broken bunker with a distinct feeling of relief. As she emerged into the thin sunlight, his eyebrows lowered behind his eyeshields. “You look spooked,” he said bluntly.
Pride tempted her to deny it, but honesty compelled her equally blunt reply. “I am.” She holstered the flashlight, giving Jensen a sidelong glance; she wondered if she was going to regret her candidness.
“Huh. So it’s not just me,” he replied, giving her what she thought was a thoughtful look—like her, Jensen wore a full-body Tyvek suit (wood camo pattern) and high-filtration mask; with his shades up, that was all she could really see of his expression. “What’s bugging you?”
Sloane blew out a heavy breath. “My brain knows better than my gut, but my gut’s not listening.” She slung her pack back on and jerked her head eastward to indicate they should get going.
Jensen fell into step beside her. “You always listen to your head over your gut?” he asked, sounding dubious.
“When my head has more pertinent information,” she said tartly, “yes. I just wish my gut would get the message and turn the damn volume down.”
He grunted, if not assent, at least acknowledgment. They moved in silence for a few minutes, then he asked, “What the hell could have done that?” From the tone of his voice, he wasn’t sure he wanted to know the answer.
“That live around here? Bison, maybe. Or bear. Lots of wildlife moved in here after the meltdown.” The ironic twist of her lips, invisible under her mask, seeped into her voice. “Turns out people are worse for wildlife than radiation.” Her mind was still going over what she’d seen down there. Jensen’s shoulders were tense. “Probably not a bear. No claw marks.”
His head turned toward her for just a moment. “Wish I could find that reassuring,” he growled.
“So do I,” Sloane sighed. “So do I.”
The shack and its mysteries were a good hour behind them; still, unease clung to them like a miasma. The undergrowth was getting thicker: the main culprit was some sort of dark fern-like ground cover. It was thick enough to conceal a large portion of the ground litter, and Sloane would probably have had a sprained ankle or two if it weren’t for her metal legs. She didn’t need a geiger counter to tell the radiation in this area had dropped, either; the insect population was higher. Bigger, too, she scowled, slapping a mosquito away from her face. “Definitely do not have enough blood in my body to feed you little shits,” she muttered.
“Where the hell did all these come from?” Jensen swatted away another with a snarl. He’d been getting steadily more irritated over the past hour; she wasn’t all that thrilled about the situation, either.
“Wetlands,” she growled. “Mosquitoes. Pretty simple math.”
“Thanks, Captain Obvious,” he muttered, quietly enough that she decided just to ignore it.
“I’ve got insect repellent in my pack,” she said instead, ruthlessly controlling her annoyance. “Let me find us a place for a break—it’s about lunch time anyway—and I’ll crack it out.” She took a few more steps, and her foot plunged through the ground cover right into an animal burrow. This one was bad enough to twist her entire leg—perfect joints didn’t have the flex of human tendons—and the connection points at her hip ached where unforgiving metal met all-too-imperfect flesh. Now it was her turn to mutter sotto voce imprecations. “Brilliant idea, Sloane. Let’s just go tramping through the biggest haunted forest in the fucking world, it’ll be fun. Radiation? Dangerous wildlife? No problem. We’ll just get eaten by the mutant mosquitoes. Come out at Pripyat as bionic mansquitoes, they’ll make a movie about us.” She yanked her foot out and stomped on. “A bad movie.”
Behind her, Jensen let out a sigh; when he finally spoke up, his tone was a good deal more civil. “Don’t beat yourself up over it,” he advised. “We didn’t have any better options. And—pretty sure you did some of the same reading I did, and none of this is in the official literature.” His voice turned wry. “Or the unofficial literature.”
Before Sloane could make sense of the fact that Jensen had actually said something to her that wasn’t either coldly professional or a barely-concealed insult, the trees thinned to reveal a small clearing up ahead. It was just what she’d been looking for. She was just about to say something when a loud crack echoed through the forest. She and Jensen froze in their tracks; the trees ahead exploded into movement. She relaxed fractionally—that, at least, was something explicable; just a flock of birds, startled by the sound.
The birds emerged into the sunlight, and—“What the hell?” Jensen sounded half-shocked, half-awed. She couldn’t fault him for either. They were about the size of a crow, but no crow sported feathers of a dark, metallic blue. Or feathered aerofoils on the legs. Or a whippy, frondlike tail and featherless head covered in a soft, jeweled hide that owed more to a lizard than a bird.
Sloane stared into the sky long after they dwindled into tiny sparkling points and disappeared, her momentary thrill of delight quickly soured by the knowledge that those birds—those creatures—were the product of no natural process she was aware of. Not even the bright spring sunlight could dispel the chill that settled over her, and it was a long several minutes before she ventured out into the meadow ahead.
She pulled out a couple sealed repellent wipes and tossed one to Jensen, then pulled her Tyvek suit down to her waist. “It’s safe enough,” she answered Jensen’s raised eyebrow. “Levels are low and there’s not a lot of dust.” She turned her back to Jensen, pulled her t-shirt off, and methodically applied the repellent to face, neck and chest. Behind her, she heard the sounds of Jensen doing the same thing. Finally, she shoved the used wipe in a pocket of her pack. “You were right,” she finally said, yanking her t-shirt back on. “My gut’s been telling me all along that something’s fucked up here.”
“Archaeopteryx,” Jensen’s awed whisper was full of wonder.
“What?” She turned. Jensen, like her, had shrugged the outer suit down to his waist. The t-shirt he wore underneath clung to broad shoulders and a muscular chest. She felt a brief pang of interest—he was just the kind of man she’d always preferred, powerful and graceful, with a dangerous edge—but regretfully, she set the thought aside; even if he had stopped seeing her as some kind of threat (something she wasn’t entirely certain of), she never mixed business with pleasure.
“Archaeopteryx,” he repeated. “One of the earliest birds. Those birds looked a lot like the reconstructions I’ve seen.”
The idea that those birds were a throwback to the earliest days of avian evolution was a contradiction to everything Sloane knew. She was all set to make an acid reply, but her HUD flashed at her in a reminder that her blood sugar was trending steadily downward. Temper, temper, she warned herself. Silently, she threw down a ground cover and pulled out the MRE she’d already opened for breakfast; Jensen followed suit. Under other circumstances, it could have been almost picniclike—a lovely meadow in the warm spring sunlight—but Sloane couldn’t shake the chill of the wrecked outpost. What could have done that? And was it still out there? She ate mechanically, most of her attention on the woods around them.
Jensen, too, was keeping a wary eye on their surroundings, but every so often those featureless lenses landed on her. Finally, he broke the silence. “Problem?”
“Archaeopteryx,” she replied. “Radiation doesn’t do that.” She held up a hand. “I’m not saying you’re wrong about what it looks like. I’m saying, contrary to popular media, ionizing radiation does not cause creatures to ‘devolve’.” She wrapped the word in air quotes. “There’s no such thing as devolution. Gamma rays do not get you a giant green rage machine and organisms do not spontaneously mutate into other forms.” She took a final slug of the strong black tea that came in the Russian ration packs, ignoring the taste; as a conveyor of caffeine and sugar, it did the job. “Natural evolution does not operate with intent. Genetic changes accumulate in the germline and get passed on to the next generation—this is a simplification, but run with it—and those changes either help a creature fit their ecological niche a little better or they don’t. Changes that help tend to get passed on; changes that don’t tend to die out pretty quickly.”
“So what are you getting at?” Jensen’s attention was now all on her.
“The likelihood that those birds could arise from natural processes is vanishingly small.” Sloane let out a sigh. “Human intervention is the only probable option.” She rolled up the detritus of her meal in a tight little ball and stuck it in a pocket of her pack. “Whatever’s going on here, it’s bigger than just Lermontov. Someone’s doing some serious bioengineering here.”
Jensen made a noncommittal little grunt. “Do we scrub?”
Sloane snorted. “Fuck no.” She stood up and folded her ground cloth with military precision, putting it back where it belonged. “You’re welcome to back out if you feel the need; I want to know what these assholes are up to.”
“Are you sure that’s a good idea?” he asked cautiously. There was a wariness about him that practically screamed that he knew something about what was going on here, but whatever it was, he wasn’t sharing.
She took the opportunity to go over her weapons one last time. “Either Lermontov is using them, in which case we clear him out and call it a day, or they’re working with him, in which case I’ll burn the place to the fucking ground.” She slid her sidearm back into its holster and snapped her head around to look at him. “You have a problem with that?”
He took a moment to finish his own cleanup before shouldering his pack and turning his expressionless gaze toward her. “No,” he finally said. “No problem.”
“Good,” she growled. “Let’s get moving.”
The sun had dipped below the treeline. Shadows stretched like long fingers all around; the afternoon breeze was cool on Sloane’s back. She rubbed the back of her neck, trying to get the taut muscles to loosen up. By her estimate, another hour would see them to the outskirts of Pripyat. Finally. Something was nagging at the back of her mind—it wasn’t just the formless worry that had dogged her steps the whole way. No, this was something specific trying to work its way up from her subconscious.
Jensen pulled ahead of her as her steps slowed and her attention shifted. She started to call out to him, tell him to slow down—and froze as her eye fell on a nearby tree. The bark had been stripped off, just about level with her eyes; part of the wood beneath had been torn into rough splinters, while other areas were worn smooth, smeared with mud and other, less identifiable substances. She hadn’t seen marks like that in over a decade. Not since—
From ahead of her came an eerie groan, the sound of stiff-spined trees forced to bend, their guttural protest seeming to come from the bowels of the earth itself, a sound that shattered the patterns of late-afternoon sunlight and reassembled them into horror. Sloane’s eyes stuttered, a wave of disorientation driving her to one knee; ghost-images danced around the edges of her vision while before her, moss and wood heaved upwards into the antlered silhouette of some monstrous forest god, an unholy amalgamation of plant and animal looming above her in the dim twilight, and while the rational part of her brain refused to acknowledge it, the primitive jelly in the back of her head reeled in terror. One eye gleamed redly as it paused, balancing delicately upon a fallen forest giant, its cloven-hooved legs looking far too fragile to support its bulk. Leaves hissed madly in an intangible wind—
Memory whispered in her ears. “…radiation has no odor or color, but it has a voice…” Invisible death sizzled static through her infolink—it wasn’t the leaves—while the geiger counter at her wrist rattled an angry counterpoint. It shocked her back to herself; she frantically turned off the infolink and closed her eyes long enough to switch them to smart-vision. When she opened her eyes, her dizziness faded as the image stabilized… but even with most of the radiation-distortions filtered out of her vision, what she saw was no less a nightmare.
It was huge—easily the size of a small car—looking oddly patchy in the infrared, its tusks easily the width and length of her forearm. She knew, intimately, what those tusks could do—felt the phantom pain in a leg that no longer existed from a wound given her by one of this monster’s much, much lesser brethren. Boars—boars weren’t supposed to grow to that size! She could see the faint ripples in the air, tiny little thermal updrafts coiling upwards—how was that thing even alive?
Though she was no longer frozen in fear, Sloane kept herself still—the last thing she wanted was that monster to notice her. With the infolink down, she couldn’t warn Jensen; she could only hope he saw what she was doing and followed her lead. The boar swung its thick, misshapen head, testing the wind, and a milky cluster of half-formed eyes surrounded by half-healed scar tissue stared blindly out at her. As it shifted, something creaked and popped, and the wood beneath it abruptly collapsed in a shower of splinters. The boar landed with a thump that shook the trees around it, shrieking its rage in a high-pitched squeal.
“Fuck!” Sloane’s worst fears were realized as Jensen’s hoarse cry drew its attention. The boar snorted, squealed again, and that was the only warning before it charged.
Jensen was fast—his pistol was out, and he was pumping bullets into the oncoming monster—bullets that, incredibly, were flattening out on the creature’s armored skull. Sloane was faster; she’d thrown herself into motion the second she’d heard him shout, but even so, she could only hope she was fast enough. The world narrowed down to her, Jensen, and the boar. Supercharged legs demanded extra oxygen, and for a handful of seconds, her lungs were able to meet the demand. The rad counter squealed more loudly than the boar as her feet tore up the ground beneath her, freeing the poison that the earth had tried to bury, and she didn’t care if it meant just a little—more—speed—
It was almost enough. She slammed into Jensen from behind, half-pushing, half-throwing him out of the way; an instant later, she was torn away from him as white-hot pain bloomed in her side and she went flying. Something smashed into her spine and skull; she slid to the ground in a stunned heap.
Somehow, she pulled her wits back together. Somehow, she dragged herself to her feet, though her left side was a single cramp from ribs to hip and her back was one massive bruise. Her HUD screamed a dozen different warnings at her; she turned them all off and staggered to where Jensen had landed in a tangle of underbrush. “Up,” she said hoarsely, in a voice she barely recognized as her own. Jensen shook his head hard, then grabbed her outstretched hand. Her muscles shrieked as she pulled him upright—no, that was the boar. “It’s coming back,” she rasped. “Run!”
They ran.
They ran, shoving their way through the overgrowth, bouncing off trees, desperately trying to escape the maddened creature bellowing its rage into the night. Sloane knew—she knew—running was the absolute worst thing to do, but climbing wasn’t an option when the stunted trees around them were barely tall enough to get them out of reach of a normal-sized boar, and bullets bounced off of its hide. Neither of them wasted time looking over their shoulders; Sloane could hear it behind them, even over her ragged breathing and the steady metronome of her heart. The thunder of its hooves as it launched into another of those devastating charges—
Was it the third? The fourth? Sloane had lost count. This time, it was Jensen that knocked them out of the boar’s path like a punch-drunk toreador. She smacked hard into a tree, feeling something go crunch inside. She tried to ignore it, to roll back to her feet, and agony lanced through her body. She crouched there on hands and knees, panting shallowly; put a hand to her side and it came away sticky with blood. Fuck. She gritted her teeth and shoved herself upright; her hand left a dark smear on the white bark.
Ahead of them, underbrush snapped and tore as the boar gathered itself to come at them again. She looked around, spending precious seconds trying to re-orient; she’d lost all track of where they were in their desperate flight—but it all looked like more of the same. No time. She chose a direction and drove herself into motion. If they could get downwind, find some trees tall enough to climb and strong enough to bear them, even a ruined cabin—something. “Gotta—keep—moving,” she gasped, and picked up her pace to a limping jog.
She’d fallen well behind Jensen; she cursed silently in Russian, knowing she was slowing them down. Her side stiffened and she missed a step, lurching against another tree. Blood trickled wetly down her flank, pooling in the bottom of her Tyvek suit and squelching with every step. She pressed her elbow against her side in a futile attempt to stem it and pushed on, stubbornly focusing only on what was right in front of her—until Jensen pulled her to a stumbling halt.
Beyond him was the wide, flat expanse of the Pripyat River, tinted a bloody red by the setting sun.
There was no more room to run.
The wind carried the fetid stink of the monster to them—belatedly, Sloane recognized the odor that had clung to the inside of the monitoring station. She could hear it picking its way through the forest; it was still hunting them, but the wind was now in their favor rather than its. Her pack—and the rifle attached—was gone, a casualty of the first attack; Jensen, though, still had his. And there was one tree, a little taller, a little sturdier, than the rest, she thought might do. A plan rapidly assembled itself in her head. “You still have your rifle,” she said, appalled at the threadiness of her voice, “and you’re trained as a sniper.” She jerked her chin at the tree in question. “I’ll draw its attention.” She swallowed against the dryness in her throat. “Have to hit a soft spot. Eye. Neck. AP if you’ve got it.” The breaking branches and low, angry grunts were coming nearer.
Jensen looked back at the river. “We could swim for it—” He sounded like that was the absolute last thing in the world he wanted to do.
Sloane shook her head sharply. “Can’t.” She pulled her arm away to reveal the shredded hole in her side. “Or climb. No time to argue.” She took a few steps to the side, bracing herself against a small copse directly across from where she expected the boar to come out. It was good to work with a professional—Jensen didn’t waste time arguing further. She pulled her sidearm, swapping the magazine for armor-piercing, while Jensen dropped his pack, slung his rifle, and swarmed up the tree she’d indicated. It swayed alarmingly, but otherwise held his weight.
The trees parted, creaking and groaning as the boar forced its way through. Its wide nostrils flared, testing the air. “Hey!” Sloane shouted, drawing the animal’s attention. In Russian, she added, «Over here, you rancid goat-fucking shit-sucking pustulent waste of bacon!» It got the intended result—the monster’s head dropped, those tusks about level with her chest. Adrenaline made everything slow down; she saw its shoulders bunch as it tensed itself to charge…
She steadied her Aspid in a textbook Weaver stance and fired—once—twice—and then she pulled it up in shock as a shadow plummeted out of the trees. Crimson light glinted off gold inlay and the monomolecular edge of his nanoblades as Jensen landed on the boar’s back, using the momentum of his drop to piledriver a bladed elbow into the boar’s spine. It shrieked furious agony, throwing its head up—Jensen sprawled along its back; driving his other nanoblade into its flesh to anchor himself. His body slewed wildly as the boar bounced up on its rear legs, squealing, teeth snapping in mid-air. Sloane dropped to a knee and sighted in on the boar’s chest. Her pistol barked a third time, and a fourth, and a dark patch spread on the dirty tan of the boar’s hair. It squealed again, dropping back to all fours; Jensen hammered the nano-blade into the boar’s spine again. And a third time. Metal grated against bone; black blood fountained out, and the boar gave one final tormented scream before collapsing in a motionless heap.
Sloane slid her sidearm back into its holster; Jensen’s nanoblades snicked back into place, the only sign of their existence the gaping holes in the arms of his suit. “Putain de merde,” she muttered.
“So,” Jensen said, still breathing hard from the exertion, “I’m guessing that giant radioactive Chernobyl boars weren’t in the literature, either?”
She shook her head, instantly regretting it as a wave of dizziness washed over her. “No,” she managed to say. “Nothing about Cherno—Chernoboars.” Her tongue felt thick, her mouth dry. “Chernobyl boars,” she articulated, carefully.
He snorted. “Chernoboar sounds about right—” As the adrenaline drained away and pain roared in to take its place, the world tilted vertiginously around her.
Sloane— She blinked; she was on the ground and wasn’t sure quite how she’d gotten there. “Sloane.” Jensen was on his knees in front of her, gently tapping her cheek with a gloved hand. “You with me?”
“Think so…” she rasped. “Je ne suis pas dans mon assiette.”
“If that means you feel like shit,” Jensen said drily, “I can believe it.” He carefully folded back the shreds of her suit around the wound. “This is bad,” he muttered. “The hell were you thinking?”
“Optimal outcome,” she forced the words through a parched throat. She leaned her head back against the trees and reached out a trembling hand to point in the general direction of his pack. “Side pocket. Medfoam injector. Yellow band.”
He was already pulling out a green-capped injector, pressing it just under her ribs. The sudden wash of clarity made her a little giddy, and she could almost feel her Sentinel reaching out greedily for the protein substrates. She could definitely feel all the nerve endings in her torn side waking back up. She clenched her teeth, refusing to scream. “Bordel de merde,” she bit out. “It didn’t hurt that much last time.” She tried to twist, to get a better look at it, and this time she couldn’t hold back a whine of pain.
“Goddamn it,” Jensen sounded somewhere between worried and exasperated. He strode back, kneeling next to her again and gently pushing her back against the trees. “Will you just sit still for a sec?”
“C’est un vrai foutoir,” she muttered, unable to break his grip.
He snorted again. “I think ‘bloody mess’ is underselling it. Hold still.” He pulled out a second injector—this one the blue-cap of a powerful painkiller.
She held up a hand—still shaking—to forestall him. “Just the biofoam. Can’t afford to be impaired.” She thought she saw the line of his jaw tighten beneath the mask, but he shoved the injector back into his pocket. She let out a faint hiss; the biofoam was exothermic, and raw nerves did not appreciate the brief flash of heat as it expanded. “Good enough.” She gave him a nod. Pushing herself to her feet still hurt like bloody fuck, but at least she wasn’t bleeding out a fist-sized hole in her side. “We can’t stay here,” she said, trying to hide the strain in her voice. “I need a few minutes to look over the body, and then we have to move.”
“What exactly to you expect to find?” Jensen’s brows were furrowed; she could only imagine his scowl.
Sloane made her unsteady way to the body of the boar; she started to crouch, but her side pinged a sharp warning. She bent down instead. It only hurt a little less. “Someone was experimenting on this poor thing,” she said. “These scars—” she indicated the scars around the unnatural eye-cluster “—are from a punch biopsy.” She ignored the fresh, dark bloodstain on its tusk, instead trying to lever the massive head aside to get a look at where her bullets had impacted. It was a struggle; she was low on both physical and bioelectric juice. Jensen made an annoyed little noise, stalked over and almost effortlessly shifted it aside. “Merci,” she muttered, and carefully lowered herself to a knee. “Look at these black patches in its hair. They’re giving off heat.” She frowned, shifting her eyesight to smart vision and back. “It’s in the blood, too. I think it’s a radiotrophic fungus.”
“Can you say that in English?” Jensen grumbled.
“Fungus that eats radioactivity and gives off heat,” she replied absently. “There’s several species that popped up here after the disaster. This is weird. Sloths are known to have a symbiotic algae that grows in its fur, but I’ve never heard of the like on wild boar.” She shook her head and, as carefully as she had knelt, pushed herself back up. Jensen extended his hand out wordlessly to offer support; for once, she wasn’t too proud to take it. “Thank you,” she murmured again. “I don’t think this is our pox reservoir. If it were…” She shuddered. “I don’t even want to think of all the contamination that would be in the final product.”
“We done here?” Jensen sounded somewhere between impatient and nervous.
“I really wish I could do a necropsy on it,” Sloane replied. “This is—this is completely unnatural. The size—this fungus—the—” she shuddered “—eyes…” She shook her head. “If this is the sort of thing that’s going on around here, I’m definitely leaning toward the ‘burn it to the ground’ end of things.” She looked down at the motionless hulk, now merely carrion; despite the terror it had put them through, she couldn’t feel anything but pity for the poor beast. “It never asked to be this way. Couldn’t even have understood what they were putting it through.” She let out a breath, feeling the burn in her side. “The good news, if you want to call it that, is that this is what wrecked that outpost. The smell is… unmistakable.”
He tilted his head thoughtfully; she couldn’t quite read the furrow of his eyebrows. “No chance it had a mate?”
Sloane felt herself blanch. “Fuck, I hope not.” She considered the possibility and finally decided, “Unlikely. Male boars have a distinctive stink that females lack. And as aggressive as he was, I can’t imagine him allowing a competitor in his territory.” She shook her head again. “There’s nothing more I can learn without—without tools and time we don’t have. And we don’t want to be here when the scavengers start showing up.” There was a branch nearby, about the right length and thickness, to act as a walking stick. “The good news is, we’re only a couple klicks from Pripyat. Even in this terrain, it’s only another hour or so.”
“I have a better idea,” Jensen rumbled, and he sounded almost—concerned. “Find ourselves a safe place and settle in for the night. You need time to heal that up.” He was quiet for a few steps. “Fact is, we both need some food and rest.”
“We’re already behind schedule,” she objected, but her heart wasn’t really in it. She ached in every muscle, not just the ones that had been torn open, and a night’s sleep and about ten thousand calories would probably go a long way to make her feel human again. “But you have a point. If we do run into something… I’m not in full fighting shape.” Now that she thought about it, there had been a possible hideout not too far down their backtrail…
Sloane leaned her head back and sighed, drinking in the warmth from the small radiant heater. Blood loss always left her chilled, especially now when she didn’t have as much blood left to lose. They’d found themselves a low-lying copse of trees and bushes; the open area inside was only a few meters across, but it was enough. She’d used the tricks picked up over a decade-plus of military bivouacs to make it both comfortable and covert.
Jensen hadn’t said much the past few hours, but it had been a thoughtful silence, not the silent fuming or angry brooding that had characterized their prior interactions. She could live with that—hell, it was almost restful—and, in any case, she had things of her own to consider. Or she would, if she could get her tired brain to focus. It wasn’t easy; the Sentinel was still battening on every spare bit of glucose her body could spare. Which reminded her—she pulled out another tube of food concentrate (this one was tuna flavor, and tasted like cheap cat food smelled) and grimaced in distaste as she sucked it down. Jensen made a soft, choked little sound as she did. She swallowed and raised an eyebrow at him. “Something funny?” After everything that had happened today, she didn’t put the heat into it that she might otherwise have.
“Good thing we recovered what was left of your pack,” he replied drily. “Otherwise I don’t know what we’d be having for breakfast.”
Sloane washed the nasty-tasting stuff down with a big swig of bug juice. “I’m sure I’d have been able to rustle something up,” she quipped.
“Sure,” he responded in kind. “Probably a lot easier when it glows in the dark.”
She let out a soft snicker of amusement. “It wouldn’t have been that bad. I made sure we were both carrying enough for a couple extra days plus concentrates in case of injury. Gotta keep the Sentinel happy.” She called up her HUD just long enough to check her blood sugars, then dismissed it again. “Another couple hours and it’ll probably be safe for me to sleep, so if you want to catch a catnap until then…”
Jensen shook his head. “Not going to sleep anytime soon. Don’t worry about me. You need it more than I do.” She could almost feel the intensity of his look, even through the shades. After a few moments, he added, “You’re not what I expected.”
Sloane shrugged, feeling the faint burn where it pulled on the healing wound. “I get that a lot,” she said, letting it hang there, as ambiguous a reply as his statement had been. What did he want?
It was his turn to be silent, clearly waiting to see if she’d follow up. When she didn’t, he let out a soft sigh. “We work pretty well together when we’re not at each other’s throats,” he offered.
“Seems like,” she said cautiously. She’d noticed the same thing; when they’d forgotten to be at odds, they were shaking out into a surprisingly effective team. She’d be lying to herself if she said she didn’t miss it; this was what her life was supposed to be, throwing herself into the breach over and over, pitting herself against the worst humanity had to offer because they had to be stopped and she by fuck was good enough to stop them. (She refused to think about how much she missed someone having her back; the last year had awakened and reinforced old, hard lessons in self-sufficiency. Relying on others wasn’t a mistake she’d make again.)
“Not going to make this easy on me, are you?” Jensen asked drily. “Look, we’ve both had reason to be sensitive around each other. Kinda hoped we were getting past it.”
Sloane stared at him with a skeptical frown. “Just like that?” she asked.
He shrugged. “You’re sitting there with a hole in your side after saving my ass, and that’s not even the first time. That’s on top of taking a bunch of shit from me that you shouldn’t have had to. Figure if you were going to stick a knife in my back, proverbial or not—” his eyebrows tilted wryly. She wondered if he was remembering her blade at his neck. “—you’d have done it already. Or just let matters take their course.”
“Trust me,” she said, as ironically as possible, “if I were going to kill you, I’d do it myself. She took another swig from her canteen. “You might even see it coming.”
She thought she saw a faint amusement in the tilt of his head. “I find that oddly reassuring,” he replied, equally ironically. “So tell me, why did you take the hit for me?”
Sloane shrugged, with only her good shoulder this time. “If I hadn’t, you’d be dead.”
The light glinted off Jensen’s lenses. “And, what, you still need me to complete the mission?” He waited for her to answer; when she didn’t, he added, “Somehow I don’t think that’s the case.”
She leaned her head back against the trees again. “Maybe I didn’t want to see anyone else served up like that saponified guy in the basement,” she said tiredly. “Because that’s what it would have done: stuck a tusk in at groin level and ripped you open up to your breastbone. Given your Sentinel, you probably wouldn’t have died immediately, just gone into hypovolemic shock as you started to bleed out. And then it would have stomped on you. A ton and a half of radioactive meat dancing on your ribs, making them go cricky-crack, squishing all the soft little organs that didn’t get ripped open by the tusk. I’d have had to shoot you myself to save you from an ugly, painful death as you rotted from the inside.”
“Jesus fuck,” he muttered. “I don’t even want to know how you know that.”
“Had one put a hole in my leg once,” Sloane replied with a morbid sort of cheer. “I’d show you the scar, but I left it somewhere in Chechnya.”
Jensen’s eyebrows furrowed behind the lenses. “The… boar?” He sounded perplexed.
“The leg,” she said drily. Jensen blanched. “The boar was a resident of good old North Carolina.” She met his—glasses. “I made the same mistake you did,” she added. “Was carrying a standard-issue 9 mil at the time, and those pissant little rounds bounced right off. One of the instructors did for it—he had a 1911 loaded with .45 ACP FMJ.” She held a palm out at about her knee level. “That boar was only about yay high.”
“Chernoboar,” Jensen shook his head. “I still have trouble believing it.”
She snorted. “I blame you.” At his startled look, she elaborated, “You were the one who wanted to make a giant monster movie. Well, there you go. Kaiju boar.”
He stared at her for a moment. “I can’t decide whether you’ve had too many meds or not enough.”
Sloane couldn’t help but let out a snicker. “Oh, definitely not enough. But since I’m lacking a glucose drip, IV painkillers and a nurse to monitor my unconscious ass, I just have to make do.” At the look of—was that actually concern?—that crossed Jensen’s face, she waved a hand in a vague little circle. “Ah, just ignore me. It’s just the blood loss.” She raised an eyebrow. “Speaking of blood loss—was I imagining things or did you actually use my name back there?”
He echoed her raised eyebrow. “And if I did?”
She shrugged. “Doesn’t matter to me one way or another,” she said, digging through her ration pack and pulling out a can labeled печеночный паштет. Also speaking of blood loss, she thought grimly. “And if you have any of these—” she showed him the label “—I’ll take them.”
“Looks delicious,” he deadpanned, fishing one out of his pack and passing it over.
“Trust me, I’m doing you a favor,” Sloane replied. “Even if you’re a fan of liver pate—” Jensen made a face, and she snorted. “Yeah. These are pretty dire, but I need the iron.” She scooped out a sizable glop and spread it on some hardtack. Her body really did need iron, because it actually tasted good. She swallowed and continued, “So is this name thing mutual, or am I still calling you ‘Agent Jensen’?”
He watched her eat with an expression midway between fascinated and revolted. “You didn’t seem to have a problem calling me ‘Walter’. Or ‘Wally’, even.”
“Legend said Evangeline and Walter are on good terms; I just played the part.” She took another bite. “Figured you were keeping your distance.” Again, she shrugged. “Probably the smart thing to do. I’m more radioactive than Chernobyl.” The bitterness in that last statement slipped out all unwilling; sharper than any knife, it flayed her pretense of nonchalance to the bone. Her eyes slid away from Jensen’s face to focus instead on the necessary work of eating. “‘Sloane’ has the advantage of being shorter, so use it if you want. I honestly don’t care.” Why should she?—she’d never hear a cheerful ‘Sarge’ or appreciative ‘Doc,’ or even the half-admiring, half-intimidated ‘Red’ ever again—names that were far more central to her identity than those of her birth.
Sloane had no idea why Jensen was suddenly being friendly. Probably figured since he hadn’t gotten what he’d been looking for one way, he’d try another. Didn’t matter. She knew, whether he understood it or not, that her guilt lay not in what she’d done, but what she hadn’t done: her people had died, every one of them, and she hadn’t lifted a hand in their defense. She’d done the unforgivable: she’d lived.
Didn’t matter what Jensen thought, or what he wanted; didn’t matter if she was radioactive or not, didn’t matter what it cost her, so long as she could finish this one last mission: take down Lermontov’s operation and get Jensen out clean. And then? Then her dead could rest.
The thought whispered in the back of her mind, unbidden: And so could she.